Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

A MODIFICATION OF UROGENITAL ENTEROCOCCUS´ VIRULENT PROPERTIES ON CONDITIONS OF INTERMICROBIAL INTERACTIONS

Potaturkina-nesterova N.I. 1 Nemova I.S. 2 Artamonova M.N. 2 Khromova E.B. 3 Khokhlova O.E. 4 Trofimova N.V. 5 Teplyakova O.V. 4 Kochergina I.A. 3
1 Togliatti State University
2 Ulyanovsk State University
3 Chelyabinsk State University
4 Krasnoyarsk State Medical University
5 Chelyabinsk State Medical Academy of the Ministry of Health and Social Development of Russia
There have been isolated strains Mycoplasma hominis and Enterococcus faecalis at women (n=168) with imflammatory disease of reproductive tract. PCR was used to detect microorganisms and identification of its genetic determinants of pathogenecity. Primer design and annealing temperature were performed using a software package «Lasergene» (USA). The studies have been revealed changes in the occurrence of genetic determinants of pathogenicity microsymbiont E.faecalis isolated from microbial consortium of women’s reproducnive tract in the presence and in the absence of mycoplasm. It has been found out that microsymbiont M. hominis resulted in increase of frequency of occurrence of genes such as cylm (toxigenicity), cpd (bacterial cytogenecity) and cps (adhesion and colonization) among enterococcus after their joint cultivation.
pathogenic potential
intermicrobial interactions
reproductive tract
microbiocoenosis
Изучение симбиозов в настоящее время заняло одно из приоритетных мест в ряду актуальных проблем современной биологии. Микроорганизмы, населяющие репродуктивный тракт женщин, представляют собой пример ассоциативного симбиоза, включающего все компоненты: макросимбионт (человек), доминантный симбионт (лактобациллы) и ассоциативные симбионты (токсоны ассоциативных микроорганизмов) [3]. Исследования в области изучения ассоциативных симбиозов направлены на изучение взаимного влияния макросимбионта и доминантного микросимбионта, а также доминантного и ассоциативных микросимбионтов.

Анализ направленности межмикробных взаимоотношений ассоциативных микросимбионтов позволяет прояснить патогенез широкого спектра заболеваний, правильно оценить происхождение тех или иных аномалий в структуре микросимбионтов, приводящих к изменению их типичных или проявлению новых биологических свойств [1,2].

В связи с этим целью исследования явилось изучение вирулентных свойств урогенитальных энтерококков при взаимодействии с микоплазмами в условиях ассоциативного симбиоза репродуктивного тракта женщин.

В ходе выполнения работы обследовано 168 женщин с воспалительными заболеваниями, среди которых 75 пациенток были больны аднекситом (44,6 %), 53 - кольпитом (31,6 %) и 40 - эндоцервицитом (23,8 %). Группа сравнения составили 75 практически здоровых женщин, репрезентативных по возрасту.

Количественную и качественную оценку состава вагинального микроценоза производили бактериологическим методом в соответствии с Приказом МЗ СССР № 535 от 22.04.85 [4,5,6]. Для выявления микоплазм использовали прямой вариант МФА с контрастированием фона, культуральный метод и ПЦР. Подбор праймеров и температуры отжига осуществляли при использовании пакета программ «Lasergene» (США).

Используемые праймеры для Enterococcus faecalis: Cylm - 5' ACAGGGAGACTCTCATAGTCGCGG 3'; Сpd - 5' CGCGTGAAGAACAAATGGCCGC 3'; Сps - 5' GGCATCGAAGCTAATGGGTGGGT 3' (табл. 1).

Таблица 1

Использованные в работе праймеры

Ген

Фактор патогенности

Пары праймеров: прямой/обратный

Размер ампликона н.п.

Праймеры энтерококков Enterococcus faecalis

1

Cylm (токси-генность, цитолизин),

5'ACAGGGAGACTCTCATAGTCGCGG 3'

5'CCCCGTGCCGGGGTGCCTGGACCTG 3'

296

2

cpd (бактерии-оциогенность)

5' CGCGTGAAGAACAAATGGCCGC 3'

5'GCTTTCCTGGTAGTTGGCGTAGG 3' '

528

3

cps (адгезия и колонизация)

5' GGCATCGAAGCTAATGGGTGGGT 3'

5' GCTTTCCTGGTAGTTGGCGTAG G 3'

298

В результате исследования установлено, что из всех обследованных женщин энтерококки были выделены из влагалищного и цервикального биотопов у 46,6 % и 26,6 % здоровых и 85,1 % и 55,9 % больных соответственно. У больных женщин энтерококки обнаруживались почти в два раза чаще, чем у здоровых. Плотность микробного обсеменения (ПМО) E. faecalis при воспалительных заболеваниях увеличивалась во влагалище в 2,1 раза, а в цервикальном канале - в 3,4 раза. Штаммы Mycoplasma hominis были выделены у всех 168 женщин.

Изучение вирулентности клинических изолятов Е. faecalis методом внутрибрюшинного заражения мышей показало, что из 237 штаммов энтерококков, выделенных у женщин с заболеваниями репродуктивной системы, только 187 (78,9 %) вызывали гибель животных, показатель LD50 /lg этих штаммов варьировал от 3,6±0,1 до 5,7±0,6. В зависимости от величины показателя штаммы были разделены на три группы. LD50/lg штаммов I группы (39 штаммов) составлял от 3,6±0,1 до 4,4±0,3; II группы - от 4,5±0,4 до 5,0±0,5 (97 штаммов) и III группы - от 5,1±0,7 до 5,7±0,6 (51 штамм).

Для оценки взаимного влияния микросимбионтов на их патогенный потенциал определяли гены, детерминирующие бактериоциногенность (cpd), адгезию (cps), а также токсигенность и цитолитическую активность(cylm) у штаммов E. faecalis (n=142), выделенных из ассоциаций с М. hominis различной степени вирулентности после их совместного культивирования, а также у энтерококков (n=87), выделенных из микробных консорциумов, где микоплазмы не являлись участником микробного сообщества. Исследования показали, что частота встречаемости гена cpd у штаммов E. faecalis, выделенных из ассоциации с микоплазмами, составила 57 %, изолированных без микоплазм - 36,7 %.

Таблица 1

Частота встречаемости нуклеотидных последовательностей гена cpd сylm, cps у культуры E. fаecalis

 

Штаммы E. fаecalis, выделенные в ассоциации с микоплазмами:

 

Совместное культивирование

Частота встречае-мости фрагмента cpd гена

(%)

Частота встречае-мости фрагмента ген cps гена (%)

Частота встречае-мости фрагмента cylm гена (%)

авирулентными (n=29)

 

до сокультивирования

3,4±0,2

4,1±0,6

6,8±0,8

после 3-х суток сокультивирования

3,8±0,5

4,9±0,8

7,3±0,3

умеренно вирулентными (n=76)

до сокультивирования

14,4±1,7

15,7 ±0,7

35,5±1,3

после 3-х суток сокультивирования

19,7±2,7*

22,3 ±2,7*

46,7±1,7*

высоко

вирулентными (n=37)

до сокультивирования

54,1±2,9

67,5±3,5

48,6±7,2

после 3-х суток сокультивирования

86,5±3,5*

92,5±4,5*

78,3±6,4 *

Выделенные в виде монокультур

до сокультивирования

3,2±0,5

3,6±0,1

2,2±0,1

после 3-х суток сокультивирования

3,7±0,7

3,9±0,7

3,1±0,2

Примечание: * - показатель достоверности различия между уровнем частоты встречаемости нуклеотидных последовательностей гена cpd у культур E. fаecalis до и после их сокультивирования с М. hominis (р<0,05).

Тестирование E. faecalis после сокультивирования с авирулентными, с умеренновирулентными и высоковирулентными микоплазмами в течение трех суток выявило достоверное (р<0,05) повышение частоты встречаемости искомых ампликонов у вирулентных штаммов (табл.1). В дальнейшие сроки исследования частота встречаемости изучаемых ампликонов не изменялась (р>0,05).

В группе энтероккоков, выделенных без микоплазм, частота встречаемости генетических детерминант сylm, cpd, cps после совместного культивирования с микоплазмами достоверно не изменялась.

Таким образом, установлено, что после сокультивирования энтерококков с микоплазмами различной вирулентности возрастает частота встречаемости всех пар праймеров сylm (токсигенность, цитолизин), cpd (бактерииоциогенность), cps (адгезия и колонизация) по сравнению с показателями, полученными до сокультивирования, что приводило к формированию более выраженной патогенности штаммов энтерококков.

Работа выполнена при поддержке ФЦП «Научные и научно-педагогические кадры инновационной России» на 2009-2013 годы (№14.B37.21.2010)

Рецензенты:

Ильина Н. А., д.б.н., профессор кафедры зоологии, проректор по научной работе ФГБОУ ВПО «Ульяновский государственный педагогический университет имени И. Н. Ульянова», г. Ульяновск.

Нестеров А. С., д.м.н., профессор кафедры инфекционных и кожно-венерических болезней ФГБОУ ВПО «Ульяновский государственный университет», г. Ульяновск.