Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 1,120

THE EFFECT OF TRANSCRIPTIONAL ACTIVITY OF GENES THAT REGULATE DNA REPAIR ON THE EFFECTIVENESS OF RADIATION THERAPY OF RECTAL TUMORS

Kutilin D.S. 1 Kosheleva N.G. 1 Gusareva M.A. 1 Kharagezov D.A. 1 Dontsov V.A. 1 Poluektov S.I. 1 Zema T.V. 1 Liman N.A. 1 Shlyakhova O.V. 1 Udalenkova I.A. 1
1 Rostov Research Institute of Oncology
Currently, the main treatment for rectal cancer remains preoperative radiation therapy, followed by surgery. However, in practice, there are cases of a lack of response in patients to preoperative radiation therapy, which is associated with the radioresistance of tumor cells, depending on their molecular genetic characteristics, in particular, reduced or increased expression of a certain group of genes. Therefore, the aim of this work was to study the effect of transcriptional activity of the BRCA2, H2AX, CASP9, RBBP8 and BCL2 genes on the effectiveness of radiation therapy of rectal tumors. The study used biopsy samples (obtained before irradiation) of 30 patients with rectal adenocarcinoma. Irradiation was carried out on a Novalis TX linear accelerator (Varian, USA) (ROD = 2.4 Gy to SOD = 54 isoGy). Using the RT-qPCR method, the relative expression values of 5 genetic loci BRCA2, H2AX, CASP9, RBBP8 and BCL2 were determined. Cluster analysis (Hierarchical Clustering, Euclidean distance) allowed us to distinguish two groups of patients that differ in the transcriptional profile of the genes: in the 1st group, the expression of the CASP9 gene was increased and the expression of the BRCA2, H2AX, RBBP8 and BCL2 genes was reduced; in group 2, the expression of the CASP9 gene is reduced and the expression of the BRCA2, H2AX, RBBP8 and BCL2 genes is increased. Analysis of clinical data on the effectiveness of radiation therapy of rectal cancer in 30 patients allowed us to establish a correspondence between complete tumor regression and increased expression of the CASP9 gene (4.5 times (p <0.005)) and reduced expression of H2AX and RBBP8 (2.0 times (p <0.05) ) (group 1), and vice versa, the absence of significant regression with increased expression of H2AX, RBBP8, BRCA2, and BCL2 (2.0, 3.0, 2.5, and 5.0 times (p <0.005), respectively) (group 2). Thus, the study made it possible to establish that the transcriptional activity of the BRCA2, H2AX, CASP9, RBBP8 and BCL2 genes affects the effectiveness of radiation therapy.
radiation therapy
rectal cancer
apoptosis
dna repair
gene expression

Колоректальный рак (КРР) – группа злокачественных новообразований кишечника, которая занимает 4-е место среди всех онкологических заболеваний по числу летальных случаев [1]. Ежегодно во всем мире фиксируют около 1 000 000 новых случаев КРР и более 700 000 смертей от этого заболевания. В последнее десятилетие в России наблюдается значительное увеличение заболеваемости КРР [2]. В данной группе заболеваний наиболее распространенными являются опухоли прямой кишки [3]. В течение последних нескольких лет диагностика и лечение опухолей прямой кишки проводятся отдельно от других отделов кишечника. Комбинированные подходы к лечению, включая хирургическое вмешательство, предоперационную и послеоперационную химио- или радиотерапию, привели к улучшению показателей выживаемости [4].

Основным эффективным методом лечения рака прямой кишки, признанным как в России, так и во всем мире, остается выполнение предоперационной лучевой терапии с последующим хирургическим вмешательством [5]. Одним из вариантов лучевой терапии является курс облучения с разовой очаговой дозой (РОД) 2,4 Гр до суммарной очаговой дозы (СОД) 54 Гр [2]. Однако в практике имеются случаи отсутствия реакции у пациентов на предоперационную лучевую терапию, что связано с радиорезистентностью опухолевых клеток, зависящей от их молекулярно-генетических особенностей [2], в частности от пониженной или повышенной экспрессии определенной группы генов.

Ранее нами в модельном эксперименте была показана ассоциация показателя копийности генов, регулирующих репарацию ДНК, клеточный цикл и апоптоз, с радиорезистентностью опухолевых клеток [6]. Поэтому целью данной работы явилось исследование влияния транскрипционной активности генов BRCA2, H2AX, , RBBP8, CASP9 и BCL2 на эффективность предоперационной лучевой терапии опухолей прямой кишки.

Материалы и методы исследования. В исследовании использовали парные препараты биопсии (полученные при ВКС до облучения) прилегающих немалигнизированных (нормальных) и опухолевых тканей прямой кишки (аденокарцинома G1-2) 30 пациентов (медиана возраста 57 лет), проходивших лечение в ФГБУ «РНИОИ» МЗ РФ в 2018–2019 гг. Лучевая терапия проводилось на линейном ускорителе Novalis TX (Varian, США) (РОД=2,4 Гр до СОД=54 Гр). Образцы биопсии мгновенно замораживали в жидком азоте без использования транспортных РНК сохраняющих сред.

Выделение тотальной РНК проводили методом, описанным Chomczynski&Sacchi. Следы геномной ДНК удаляли с помощью ДНК-азы. Для синтеза библиотек комплементарной ДНК (кДНК) использовали наборы Reverta-L («Интерлабсервис», Россия) [7]. Методом RT-qPCR определяли величины относительной экспрессии 5 генетических локусов: BRCA2, H2AX, CASP9, RBBP8 и BCL2. В качестве референсных использовали гены GAPDH, ACTB и B2M. Последовательности высокоспецифичных олигонуклеотидов (праймеров) (табл. 1) разрабатывали с использованием NCBI GenBank и программы Primer-BLAST.

Таблица 1

Последовательности синтетических олигонуклеотидов

Наименование праймеров

Хромосомная локализация

Последовательность

H2AX_F

H2AX_R

Chr 11: 119.09 – 119.1

GCACTTGGTAACAGGCACATC

ACTCCCCAATGCCTAAGGTT

RBBP8_F

RBBP8_R

Chr 18: 22.8 – 23.03

GCGAGTATTTTGGTATTTGACCTGT

AGCTGCTTCCCGAGATGTTC

BRCA2_F

BRCA2_R

Chr 13: 32.32 – 32.4

AGTTGGCTGATGGTGGATGG

GGATCCACACCTGGAGTGTC

BCL2_F

BCL2_R

Chr 18: 63.12 – 63.32

GGATCCAGGATAACGGAGGC

GAAATCAAACAGAGGCCGCA

CASP9_F

CASP9_R

Chr 1: 15.49 – 15.53

TGAGACCCTGGACGACATCT

TCCCTTTCACCGAAACAGCA

GAPDH_F

GAPDH_R

Chr 12: 6.53 – 6.54

GTCAAGGCTGAGAACGGGAA

TCGCCCCACTTGATTTTGGA

B2M_F

B2M_R

Chr 15: 44.71 – 44.72

AGATGAGTATGCCTGCCGTG CCATGATGCTGCTTACATGTCTC

ACTB_F

ACTB_R

Chr 7: 5.53 – 5.56

AACCGCGAGAAGATGACCC

AGCACAGCCTGG TAGCAAC

 

RT-PCR-амплификацию библиотек к ДНК проводили в 25 мкл реакционной смеси (12 нг кДНК, 0,25 мМ dNTPs, 2,5 мМ MgCl2, 1х-ый ПЦР-буфер и 1 ед. акт. SynTaq ДНК-полимеразы, 1х-ый краситель EVA-Green и по 500 нМ прямого и обратного праймеров) по следующей программе: денатурация: t=95°С 3 мин; далее 40 циклов: t=95°С 10 секунд, t=57°С 30 секунд (считывание флуоресцентного сигнала), t=72°С 30 секунд. Транскрипционную активность генетического локуса (RЕ) рассчитывали по формуле RЕ =2-ΔΔCt[7].

Статистический анализ выполняли в пакете программ Statistica 10. Для оценки нормальности распределения показателей применяли критерий Шапиро–Уилка (n<50). Для оценки различий использовали критерий Манна–Уитни для порогового уровня статистической значимости р<0,05. Для построения тепловых карт (Heatmap) и кластерного анализа (Hierarchical Clustering, Euclidean distance) применяли скрипты (собственной разработки) в среде программирования R (R-Studio версия 8.10.173.987) [6].

Результаты исследования и их обсуждение

Полученные в исследовании данные по транскрипционной активности 5 генетических локусов в биопсийных образцах опухолевой ткани были подвергнуты кластерному анализу (Hierarchical Clustering, Euclidean distance) (рис. 1).

Рис. 1. Результаты кластерного анализа и тепловая карта транскрипционной активности генов в опухолевой ткани прямой кишки (n=30)

Как видно из представленных данных, было выделено два кластера – две группы пациентов, отличающихся по транскрипционному профилю генов BRCA2, H2AX, CASP9, RBBP8 и BCL2. В первой группе у 81% пациентов повышена экспрессия гена CASP9, у 100% снижена экспрессия генов BRCA2, H2AX, RBBP8 и BCL2. Во второй группе у 100% пациентов снижена экспрессия гена CASP9 и у 93% повышена экспрессия генов BRCA2, H2AX, RBBP8 и BCL2.

Сами генетические локусы также были разделены на разные кластеры, соответствующие выполняемой ими функции: BRCA2, H2AX, RBBP8 – регуляция репарации ДНК, CASP9 – проапоптозная функция, BCL2 – антиапоптозная функция. Визуально взаимодействие данных генов, а также сила этих взаимодействий представлены на рисунке 2 (рассчитано с помощью GIANT [8]). Эти гены являются компонентами различных сигнальных путей, а изменение их транскрипционной активности, вероятно, опосредованное изменением копийности [6], приводит к изменению экспрессии целого ряда других генов (рис. 3).

С помощью онлайн-сервиса GeneMANIA (Gene Multiple Association Network Integration Algorithm) были оценены особенности взаимодействия между генами BRCA2, BCL2, H2AX, RBBP8, CASP9 и SPO11, FKBP8, RAD50, APPL1, MRE11A, NBN, TP53BP1, RAD51, MDC1, DIABLO, APAF1, BIK, ATM, XRCC3, TEX15, PALB2, CASP6, BRCA1, MND1, GSN (табл. 2).

Рис. 2. Схема взаимодействия и сила взаимосвязи генов CASP9, BCL2, BRCA2, H2AX и RBBP8 в тканях прямой кишки

GeneMANIA использует алгоритм машинного обучения и предсказывает функцию генов в составе сложной сети из множества генов, присваивает оценку каждому узлу построенной сети. Эта оценка отражает силу связи [6].

Из представленных в таблице функций генов достаточно часто встречается такая, как изменение конформации ДНК. Эукариотическая ДНК упакована в виде хроматина, что представляет собой преграду для процессов, требующих взаимодействия ферментов с определенными сайтами ДНК. Поэтому для репарации ДНК после облучения хроматин должен быть ремоделирован [6].

Ген H2AX кодирует соответствующий гистоновый белок, который в ответ на двухцепочечные разрывы в ДНК, вызванные ионизирующим излучением, фосфорилируется по серину (γH2AX). За этот процесс ответственны киназы семейства PI3, в частности ATM (Ataxia telangiectasia mutated). Из-за этой модификации ДНК становится менее конденсированной, появляется место для присоединения белковых комплексов, необходимых для осуществления репарации [9].

Рис. 3. Взаимодействия генов BCL2, BRCA2, H2AX, CASP9, RBBP8, рассчитанные с помощью алгоритма GeneMANIA

Таблица 2

Взаимодействия генов BCL2, BRCA2, H2AX, CASP9, RBBP8, вычисленные с помощью GeneMANIA

Ген

Индекс

Функция

Ссылки

RBBP8

0.66

Контроль клеточного цикла, контроль повреждения ДНК,

восстановление двухцепочечного разрыва, репарация повреждения ДНК

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=100616139

BRCA2

0.61

Восстановление двухцепочечных разрывов посредством гомологичной рекомбинации

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=675

H2AFX

0.56

Контроль клеточного цикла, изменение конформации ДНК, контроль повреждения ДНК,

восстановление двухцепочечного разрыва посредством гомологичной рекомбинации,

регуляция ответа на повреждения ДНК, регуляция клеточного ответа

на стресс, регуляция репарации ДНК, реакция на ионизирующее излучение

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=3014

BCL2

0.55

Регуляция апоптотического сигнального пути в ответ на повреждение ДНК, в ответ на радиацию

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=596

CASP9

0.54

Активация эндопептидазы цистеинового типа, участвующей в апоптотическом процессе,

клеточный ответ на радиацию, сигнальный путь апоптоза в ответ на повреждение ДНК,

позитивная регуляция запрограммированной гибели клеток

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=842

SPO11

0.07

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=23626

FKBP8

0.07

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=23770

RAD50

0.05

АТФ-зависимая ДНК-геликазная активность, изменение конформации ДНК,

геометрическое изменение ДНК, восстановление двухцепочечного разрыва посредством

гомологичной рекомбинации, реципрокная мейотическая рекомбинация

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=10111

APPL1

0.05

Положительная регуляция апоптоза

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=26060

MRE11A

0.05

Изменение конформации ДНК, рекомбинация ДНК, восстановление двухцепочечных разрывов

посредством гомологичной рекомбинации, поддержание теломер

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=4361

NBN

0.05

Изменение конформации ДНК, рекомбинация ДНК, восстановление двухцепочечных разрывов

посредством гомологичной рекомбинации, поддержание теломер

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=4683

TP53BP1

0.04

Восстановление двухцепочечных разрывов посредством гомологичной рекомбинации

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=7158

RAD51

0.04

Изменение конформации ДНК, геометрическое изменение ДНК, восстановление двухцепочечного

разрыва посредством гомологичной рекомбинации

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=5888

MDC1

0.04

Контроль целостности ДНК, восстановление двухцепочечного разрыва

с помощью гомологичной рекомбинации

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=9656

DIABLO

0.04

Активация эндопептидазы цистеинового типа, позитивная регуляция апоптотического процесса

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=56616

APAF1

0.04

Активация эндопептидазы цистеинового типа, позитивная регуляция апоптотического процесса

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=317

BIK

0.03

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=638

ATM

0.03

Контроль клеточного цикла и клеточного ответа на радиацию,

восстановление двухцепочечных разрывов,

позитивная регуляция запрограммированной гибели клеток

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=472

XRCC3

0.02

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=7517

TEX15

0.02

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=56154

PALB2

0.02

Восстановление двухцепочечного разрыва с помощью гомологичной рекомбинации

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=79728

CASP6

0.02

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=839

BRCA1

0.02

Контроль клеточного цикла, передача сигнала p53, восстановление

двухцепочечного разрыва посредством гомологичной рекомбинации,

регуляция репарации ДНК и реакции на ионизирующее излучение

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=672

MND1

0.02

http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=search&term=84057

GSN

0.02

http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000148180

 

Далее с комплексом γH2AX/MDC1 связываются две убиквитинлигазы – RNF8 и RNF168, которые осуществляют убиквитилирование других компонентов хроматина, что в итоге позволяет BRCA1 присоединиться к модифицированному γH2AX/MDC1 хроматину [10]. На участке γH2AX-модифицированного хроматина также собирается комплекс MRN (состоящий из Mre11, Rad50 и Nbs1), RAD51 и АТМ [11]. Для перемещения белка RAD51 к двухцепочечному разрыву в ДНК требуется образование комплекса BRCA1-PALB2-BRCA2 [12]. Его образованию способствует модулирующее действие на функции BRCA1 белка, кодируемого геном RBBP8 [13]. Соответственно гиперэкспрессия генов BRCA2, H2AX и RBBP8 в клетках опухолей прямой кишки может повышать эффективность работы системы репарации ДНК и обеспечивать их выживание при воздействии лучевой терапии.

Продукты генов BCL2 и CASP9 вовлечены в регуляцию апоптоза. BCL2 является антиапоптозным белком, контролирует проницаемость митохондриальной мембраны и ингибирует каспазы за счет предотвращения выхода цитохрома C из митохондрий и за счет связывания APAF1 – фактора, активирующего апоптоз. Инициаторная каспаза CASP9 выполняет критическую для запуска апоптоза функцию [6].

Можно предложить, что в первой группе пациентов, где повышена экспрессия проапоптозного гена CASP9 и снижена экспрессия антиапоптозного гена (BCL2) и генов, регулирующих репарацию ДНК (BRCA2, H2AX, RBBP8), воздействие лучевой терапии окажется более эффективным в силу сниженной активности репарационной системы и повышенной чувствительности к стрессиндуцированному апоптозу, чем во второй группе.

Последующий анализ результатов лучевой терапии рака прямой кишки у 30 пациентов позволил подтвердить это предположение. Так, у 16 пациентов после лучевой терапии наблюдался полный регресс опухоли, при этом в их опухолевом биопсийном материале экспрессия генов H2AX и RBBP8 была снижена в 2,0 раза (р<0,05), а экспрессия гена CASP9 повышена в 4,5 раза (р<0,005) относительно нормальной ткани. У 8 пациентов наблюдался незначительный регресс опухоли, а у 6 пациентов регресс отсутствовал, при этом у них статистически значимо (р<0,005) экспрессия генов BRCA2, H2AX, RBBP8 и BCL2 была выше в 2,5, 4,0, 6,0 и 3,3 раза соответственно (в 2,0, 3,0, 2,5 и 5,0 раз относительно нормы), а гена CASP9 – в 4,5 раза ниже, чем экспрессия у пациентов с полным регрессом опухоли (рис. 4).

Рис. 4. Транскрипционная активность генов в опухолевой ткани прямой кишки

у двух групп больных (с полным регрессом или его отсутствием).

* – статистически значимые отличия относительно нормы (р<0,005),

** – статистически значимые отличия одной группы от другой

Заключение. Таким образом, проведенное исследование позволило установить, что транскрипционная активность генов BRCA2, H2AX, CASP9, RBBP8 и BCL2 влияет на эффективность лучевой терапии, которая возрастает у пациентов с повышенной экспрессией гена CASP9 и сниженной экспрессией H2AX и RBBP8, и наоборот – эффективность терапии падает при повышенной экспрессии H2AX, RBBP8, BRCA2 и BCL2.

Работа выполнена в рамках госзадания «Поиск предикторов радиорезистентности рака прямой кишки и разработка персонифицированных неоадьювантных терапевтических подходов».