Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,813

THEORETICAL AND EXPERIMENTAL APPROACH IN CHOLESTEROL INFLUENCE ON FUNCTIONAL ACTIVITY OF DNA

Sidorov D.I. 1 Trofimov V.A. 1
1 Mordovian State University
С помощью биоинформатического подхода и метода компьютерного моделирования проанализирована вероятность связывания холестерина (ХС) с регуляторно-промоторной областью гена р53 человека. В опытах invitro показано, что холестерин взаимодействует с олигонуклеотидной последовательностью участка гена минимально с тремя нуклеотидами. Выявлено, что наиболее предпочтительными сайтами связывания холестерина с олигонуклеотидными последовательностями ДНК являются триплеты: ctAAAaa, agTATct, ttTTAac, фланкированные определенными нуклеотидами. ДНК в комплексе с холестерином гидролизуется HinfI по сайтам рестрикции с различной эффективностью. Определяющим фактором является значение рН среды. Наиболее полная рестрикция комплекса ДНК-ХС происходит в сильнощелочной среде, наименее полная в слабощелочной среде. Полученные данные свидетельствуют о возможном влиянии холестерина на транскрипционную активность гена и его регуляторной роли в экспрессии генов.
Using bioinformatics approach and a method of computer modeling analyzed the probability of binding cholesterol from the regulatory and promoter region of the human p53 gene. The invitro experiments demonstrated that cholesterol is reacted with the oligonucleotide sequence portion of the gene with minimal three nucleotides. It was found that the most preferred binding sites for cholesterol with oligonucleotide sequences of DNA triplets are: ctAAAaa, agTATct, ttTTAac, flanked by certain nucleotides.DNAcomplexed with cholesterol hydrolyzed by HinfI restriction sites with different efficiency. The determining factor is the pH values. The most complete restriction of the DNA-cholesterol takes place in a highly alkalineenvironment, the least complete in a slightly alkaline environment. These data suggest a possible effect of cholesterol on the transcriptional activity of the gene and its regulatory role in gene expression.
activity restriction HinfI.
bioinformatics approach
the human p53 gene promoter
cholesterol
ДНК – сложная биоорганическая молекула, существующая в виде надмолекулярного нуклеопротеидного комплекса – хроматина, конформация которого динамично изменяется в зависимости от набора взаимодействующих с ним биомолекул.

В составе хроматина, кроме белков, обнаружены фосфолипиды и нейтральные липиды. Причем состав липидов хроматина отличается по качественному и количественному составу от липидов ядерных мембран и изменяется при изменении функционального статуса хроматина [3,4,5]. В настоящее время показано, что взаимодействие с нуклеотидными последовательностями хроматина различных химических соединений, в частности низкомолекулярных веществ (липидов, ионов металлов, биологически активных веществ) играет важнейшую роль в регуляции функциональной активности ДНК, реализуемой в различных генетических процессах (репликации, транскрипции, репарации, рекомбинации) [3,4].

По-видимому, изменение липидного состава может выступать в качестве одного из механизмов регуляции генной экспрессии, основанной на динамичности конформации ДНК, определяемой не только белками, но и липидами. В связи с этим актуальной задачей является поиск регуляторных молекул, способных взаимодействовать с нуклеотидными последовательностями ДНК и изменять функциональную активность генов и других структурных элементов ДНК.

В настоящем исследовании с помощью биоинформатического подхода и метода компьютерного моделирования изучена способность холестерина взаимодействовать с ДНК и экспериментально оценены некоторые возможные функциональные последствия образования подобного молекулярного комплекса.

Материалы и методы исследования. Молекулярную динамику взаимодействия холестерина с олигонуклеотидной последовательностью регуляторно-промоторной области гена р53 человека (http://www.ncbi.nlm.nih.gov) проводили с помощью программы HyperChem 7.0, расчеты проводили методом молекулярной механики Mm+.

Выделение ДНК проводили согласно методике Laura-LeeBoodram с небольшими модификациями [6].

Амплификацию фрагмента ДНК размером 152 п.н., содержащего сайт рестрикции к рестриктазе HinfI, проводили с использованием фланкирующих праймеров: F 5’agcagtctgtctcctccaaa, R 5’cgatatttggatcacatttctg в амплификаторе Veriti. Параметры циклов ПЦР:

1)  95ºС – 180 сек. – 1 цикл;

2)  60ºС – 30 сек.

3)  72ºС – 30 сек.          30 циклов.

4)  95ºС – 20 сек.

Рестрикцию проводили с помощью рестриктазы HinfI, реакционную смесь, содержащую рестриктазу, SE-буферО (50 мМTris-HCl, 10 мМMgCl2, 100 мМNaCl, 1 мМDTT) и ампликоны, инкубировали в течение 1 часа при 37 ºС.

Электрофорез проводили в полиакриламидном геле (36 мл 0,5х TBE, 9 мл 30% PAAG, 250 мклPSA, 40 мклTEMED), содержащем бромистый этидий (0,5 мг/л) при разных значениях pH.

Результаты исследования и их обсуждение. Для обоснования целесообразности исследования влияния холестерина (ХС) на конформацию ДНК нами проведено моделирование взаимодействия ХС с фрагментами ДНК.

Способность ХС к взаимодействию с ДНК оценивалась путем определения энергетически выгодного расположения липида в бороздках В-формы двойной спирали фрагмента ДНК, соответствующей промоторной последовательности гена р53, а также энергии образования комплексов липид-ДНК. Критерием наиболее вероятного связывания ХС с участком молекулы ДНК являлось значение энергии связи. Энергия связи ДНК с ХС определялась как разность полных энергий комплекса ДНК-ХС и изолированных молекул ДНК и ХС. Молекулы ХС, с учетом геометрических особенностей В-формы двойной спирали ДНК, размещались в малой бороздке [1,2].

Ранее показано, что взаимодействие холестерина с ДНК (АТ)5(ТА)5 более сильное, чем с ДНК (ГЦ)5(ГЦ)5 [1].

Нами в компьютерном эксперименте показано, что наиболее предпочтительными сайтами связывания ХС с ДНК являются последовательности: ctAAAaa, agTATct, ttTTAac и некоторые другие (табл. 1). 

Таблица 1

Наиболее предпочтительные сайты связывания холестерола с ДНК

 

Последовательность

Есвkal/mol

1

ctAAAaa

43.53

2

agTATct

42.77

3

ttTTAac

42.54

4

ccAAAat

42.1

5

taGGGtg

41.43

6

acCCCaa

41.3

7

ctGGGct

41.17

8

agAAAac

40.76

9

tcGGGct

40.62

10

aaAAAtg

40.55

11

gcAAAag

40.24

12

ttTTCca

40.1

 

Поскольку наибольшую энергию связи ХС образует в комплексе с тремя нуклеотидами ДНК, то в дальнейших экспериментах молярное соотношение холестерола и анализируемых олигонуклеотидов определялось как 1:3.

Исходя из наличия более или менее предпочтительных сайтов связывания ХС с ДНК, мы выявили наличие этих участков на последовательности гена, включающего область промотора гена р53 (рис. 1). 

 

Рис. 1. Места возможного связывания холестерина с промоторной областью гена р53

 

Поиск триплетов, обладающих повышенным сродством к определенным последовательностям ДНК, показал, что они распределены по олигонуклеотидной последовательности неравномерно. В частности, в области -48 – -24 промотора гена р53 человека существует последовательность, с которой связывается транскрипционный фактор белка р53 (на рисунке выделено желтым цветом). В этой области не содержится ни одного триплета с характерным фланкированием для предпочтительного связывания с ХС. Всего триплетов с характерным рисунком фланкирования для предпочтительного связывания ХС на фрагменте анализируемого гена длиной 680 нуклеотидов – 14, что является косвенным подтверждением неравномерного распределения липидов в разных локусах ДНК.

В эксперименте изучали взаимодействие ХС с амплифицированным фрагментом ДНК, содержащим сайт рестрикции к рестриктазе HinfI размером 152 п.н. с использованием фланкирующих праймеров: F 5’agcagtctgtctcctccaaa, R 5’cgatatttggatcacatttctg. Данный фрагмент содержал замену нуклеотида в положении gtttg:

аgcagtctgtctcctccaaacagagggtcaccggtttggacttcatccctgggctccatcctgtcctgagtttgtccaagatggaccagaccctggcgatctaccaacagatcctcaccagtctgccttccagaaatgtgatccaaatatcg

            К ампликонам добавляли холестерин в концентрации 1:3, 1:6, 1:9 и инкубировали в течение 60 минут. Для рестрикции данного фрагмента использовали эндонуклеазу HinfI (рис. 2).

            Результаты экспериментов свидетельствуют о том, что при рН 8,3 HinfI полностью рестрицирует ампликоны как в контроле, так и при воздействии ХС в различной концентрации (рис. 2А). При увеличении значения рН до 9,4 способность HinfI рестрицировать ампликоны по сравнению с контролем не изменилась, однако в этом случае рестрикция всех образцов ДНК была не полной (рис. 2В). Однако при значениях рН 7,4 по сравнению с контролем способность HinfI рестрицировать ампликоны понижается (рис. 2Б).

 

рН 8,3

рН 7,4

рН 9,4

ДНК

Рестрикт

ДНК

Рестрикт

ДНК

Рестрикт

К1   2   3

К 1   2   3

К  1   2   3

К   1  2  3

К   1   2  3

К   1    2    3

днк+хс июль 1

                                                                 А                                             Б                                     В

Рис. 2. Электрофореграмма геля с ДНК и рестриктами

(К – контроль (проба без холестерина); 1 – соотношение ДНК:ХС – 1:3; 2 – соотношение ДНК:ХС – 1:6; 3 – соотношение ДНК:ХС – 1:9)

 

Таким образом, рестриктаза режет комплекс ДНК-ХС по сайтам рестрикции с разной эффективностью в слабощелочной и сильнощелочной средах.

По-видимому, при снижении величины отрицательного заряда ДНК, сродство ХС к олигонуклеотидам ДНК возрастает, а образующийся устойчивый комплекс ДНК-ХС подвергается рестрикции в меньшей степени. При смещении рН в щелочную область величина отрицательного заряда олигонуклеотидов возрастает, вследствие чего сродство ХС к ДНК уменьшается.

            Известно, что при действии повышенных температур в щелочной среде ДНК начинает разворачиваться, расплетаться. В клетке хроматиновая ДНК тоже локально расплетается при генетических процессах, в результате чего изменяется величина отрицательного заряда, что может выступать фактором изменения сродства биомолекул, в частности, холестерина к определенным нуклеотидным последовательностям и играть регуляторную роль, по крайней мере, изменяя чувствительность к действию ферментов, в том числе к нуклеазам.

Рецензенты:

Ерофеев В.И., д.б.н., профессор, проректор по учебной и методической работе ФГБОУ ДПОС «Мордовский институт переподготовки кадров агробизнеса», г. Саранск;

Шубина О.С., д.б.н., профессор, зав. кафедрой биологии, географии и методик обучения ФГБОУ ВПО «МГПИ им. М.Е. Евсевьева», г. Саранск.