Сетевое издание
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

ТЕОРЕТИЧЕСКОЕ И ЭКСПЕРИМЕНТАЛЬНОЕ ОБОСНОВАНИЕ ВЛИЯНИЯ ХОЛЕСТЕРИНА НА ФУНКЦИОНАЛЬНУЮ АКТИВНОСТЬ ДНК

Сидоров Д.И. 1 Трофимов В.А. 1
1 ФГБОУ ВПО «МГУ им. Н. П. Огарева»
С помощью биоинформатического подхода и метода компьютерного моделирования проанализирована вероятность связывания холестерина (ХС) с регуляторно-промоторной областью гена р53 человека. В опытах invitro показано, что холестерин взаимодействует с олигонуклеотидной последовательностью участка гена минимально с тремя нуклеотидами. Выявлено, что наиболее предпочтительными сайтами связывания холестерина с олигонуклеотидными последовательностями ДНК являются триплеты: ctAAAaa, agTATct, ttTTAac, фланкированные определенными нуклеотидами. ДНК в комплексе с холестерином гидролизуется HinfI по сайтам рестрикции с различной эффективностью. Определяющим фактором является значение рН среды. Наиболее полная рестрикция комплекса ДНК-ХС происходит в сильнощелочной среде, наименее полная в слабощелочной среде. Полученные данные свидетельствуют о возможном влиянии холестерина на транскрипционную активность гена и его регуляторной роли в экспрессии генов.
рестрикционная активность HinfI.
биоинформатический подход
промотор генар53
холестерин
1. Бойко Н.И. Моделирование взаимодействия ДНК с диглицеридами / Н.И. Бойко, Р.И. Жданов, Е.П. Дьячков и др. // Известия Академии наук. Серия химическая. – 2008. – № 8. – С. 1741-1744.
2. Жданов Р.И. Структура и стабильность комплексов олигомеров ДНК с жирными кислотами по данным молекулярной механики / Р.И. Жданов, Е.П. Дьячков, Н.Б. Стражевская и др. // Доклады Академии наук. – 2003. – Т. 390, № 4. – С. 548-552.
3. Жданов Р.И. Структурная липидомика. Холестерин и его эфиры в геномной ДНК эукариот: биохимический анализ и компьютерное моделирование / Р.И. Жданов, Е.П. Дьячков, Н.Б. Стражевская и др. // Патогенез. – 2003. – № 1. – С. 55-61.
4. Трофимов В. А. Влияние холестерола на экспрессию генов раннего ответа и митотическую активность перитонеальных макрофагов /В.А. Трофимов, О.Н. Аксенова, А.В. Никулин, М.В. Ромашкина, Е.А. Иванова // Казанский медицинский журнал. – 2009. – Т. 90, № 4. – С.560-563.
5. Трофимов В. А. Характеристика спектра липидов фракций хроматина клеток печени мышей после частичной гепатэктомии / В. А. Трофимов, А. А. Дудко // Бюллетень экспериментальной биологии и медицины. – 2006. – Т. 141, № 1. – С. 85–88.
6. Boodram Laura-Lee. Extraction of genomic DNA from whole blood / Protocol Online – Your Lab's Reference Book – online database of research protocols in a variety of life science fields [Electronic resource]. 1999–2006. Mode of access: http://www.protocol-online.org/prot/Protocols/Extraction-of-genomic-DNA-from-whole-blood-3171.html
ДНК – сложная биоорганическая молекула, существующая в виде надмолекулярного нуклеопротеидного комплекса – хроматина, конформация которого динамично изменяется в зависимости от набора взаимодействующих с ним биомолекул.

В составе хроматина, кроме белков, обнаружены фосфолипиды и нейтральные липиды. Причем состав липидов хроматина отличается по качественному и количественному составу от липидов ядерных мембран и изменяется при изменении функционального статуса хроматина [3,4,5]. В настоящее время показано, что взаимодействие с нуклеотидными последовательностями хроматина различных химических соединений, в частности низкомолекулярных веществ (липидов, ионов металлов, биологически активных веществ) играет важнейшую роль в регуляции функциональной активности ДНК, реализуемой в различных генетических процессах (репликации, транскрипции, репарации, рекомбинации) [3,4].

По-видимому, изменение липидного состава может выступать в качестве одного из механизмов регуляции генной экспрессии, основанной на динамичности конформации ДНК, определяемой не только белками, но и липидами. В связи с этим актуальной задачей является поиск регуляторных молекул, способных взаимодействовать с нуклеотидными последовательностями ДНК и изменять функциональную активность генов и других структурных элементов ДНК.

В настоящем исследовании с помощью биоинформатического подхода и метода компьютерного моделирования изучена способность холестерина взаимодействовать с ДНК и экспериментально оценены некоторые возможные функциональные последствия образования подобного молекулярного комплекса.

Материалы и методы исследования. Молекулярную динамику взаимодействия холестерина с олигонуклеотидной последовательностью регуляторно-промоторной области гена р53 человека (http://www.ncbi.nlm.nih.gov) проводили с помощью программы HyperChem 7.0, расчеты проводили методом молекулярной механики Mm+.

Выделение ДНК проводили согласно методике Laura-LeeBoodram с небольшими модификациями [6].

Амплификацию фрагмента ДНК размером 152 п.н., содержащего сайт рестрикции к рестриктазе HinfI, проводили с использованием фланкирующих праймеров: F 5’agcagtctgtctcctccaaa, R 5’cgatatttggatcacatttctg в амплификаторе Veriti. Параметры циклов ПЦР:

1)  95ºС – 180 сек. – 1 цикл;

2)  60ºС – 30 сек.

3)  72ºС – 30 сек.          30 циклов.

4)  95ºС – 20 сек.

Рестрикцию проводили с помощью рестриктазы HinfI, реакционную смесь, содержащую рестриктазу, SE-буферО (50 мМTris-HCl, 10 мМMgCl2, 100 мМNaCl, 1 мМDTT) и ампликоны, инкубировали в течение 1 часа при 37 ºС.

Электрофорез проводили в полиакриламидном геле (36 мл 0,5х TBE, 9 мл 30% PAAG, 250 мклPSA, 40 мклTEMED), содержащем бромистый этидий (0,5 мг/л) при разных значениях pH.

Результаты исследования и их обсуждение. Для обоснования целесообразности исследования влияния холестерина (ХС) на конформацию ДНК нами проведено моделирование взаимодействия ХС с фрагментами ДНК.

Способность ХС к взаимодействию с ДНК оценивалась путем определения энергетически выгодного расположения липида в бороздках В-формы двойной спирали фрагмента ДНК, соответствующей промоторной последовательности гена р53, а также энергии образования комплексов липид-ДНК. Критерием наиболее вероятного связывания ХС с участком молекулы ДНК являлось значение энергии связи. Энергия связи ДНК с ХС определялась как разность полных энергий комплекса ДНК-ХС и изолированных молекул ДНК и ХС. Молекулы ХС, с учетом геометрических особенностей В-формы двойной спирали ДНК, размещались в малой бороздке [1,2].

Ранее показано, что взаимодействие холестерина с ДНК (АТ)5(ТА)5 более сильное, чем с ДНК (ГЦ)5(ГЦ)5 [1].

Нами в компьютерном эксперименте показано, что наиболее предпочтительными сайтами связывания ХС с ДНК являются последовательности: ctAAAaa, agTATct, ttTTAac и некоторые другие (табл. 1). 

Таблица 1

Наиболее предпочтительные сайты связывания холестерола с ДНК

 

Последовательность

Есвkal/mol

1

ctAAAaa

43.53

2

agTATct

42.77

3

ttTTAac

42.54

4

ccAAAat

42.1

5

taGGGtg

41.43

6

acCCCaa

41.3

7

ctGGGct

41.17

8

agAAAac

40.76

9

tcGGGct

40.62

10

aaAAAtg

40.55

11

gcAAAag

40.24

12

ttTTCca

40.1

 

Поскольку наибольшую энергию связи ХС образует в комплексе с тремя нуклеотидами ДНК, то в дальнейших экспериментах молярное соотношение холестерола и анализируемых олигонуклеотидов определялось как 1:3.

Исходя из наличия более или менее предпочтительных сайтов связывания ХС с ДНК, мы выявили наличие этих участков на последовательности гена, включающего область промотора гена р53 (рис. 1). 

 

Рис. 1. Места возможного связывания холестерина с промоторной областью гена р53

 

Поиск триплетов, обладающих повышенным сродством к определенным последовательностям ДНК, показал, что они распределены по олигонуклеотидной последовательности неравномерно. В частности, в области -48 – -24 промотора гена р53 человека существует последовательность, с которой связывается транскрипционный фактор белка р53 (на рисунке выделено желтым цветом). В этой области не содержится ни одного триплета с характерным фланкированием для предпочтительного связывания с ХС. Всего триплетов с характерным рисунком фланкирования для предпочтительного связывания ХС на фрагменте анализируемого гена длиной 680 нуклеотидов – 14, что является косвенным подтверждением неравномерного распределения липидов в разных локусах ДНК.

В эксперименте изучали взаимодействие ХС с амплифицированным фрагментом ДНК, содержащим сайт рестрикции к рестриктазе HinfI размером 152 п.н. с использованием фланкирующих праймеров: F 5’agcagtctgtctcctccaaa, R 5’cgatatttggatcacatttctg. Данный фрагмент содержал замену нуклеотида в положении gtttg:

аgcagtctgtctcctccaaacagagggtcaccggtttggacttcatccctgggctccatcctgtcctgagtttgtccaagatggaccagaccctggcgatctaccaacagatcctcaccagtctgccttccagaaatgtgatccaaatatcg

            К ампликонам добавляли холестерин в концентрации 1:3, 1:6, 1:9 и инкубировали в течение 60 минут. Для рестрикции данного фрагмента использовали эндонуклеазу HinfI (рис. 2).

            Результаты экспериментов свидетельствуют о том, что при рН 8,3 HinfI полностью рестрицирует ампликоны как в контроле, так и при воздействии ХС в различной концентрации (рис. 2А). При увеличении значения рН до 9,4 способность HinfI рестрицировать ампликоны по сравнению с контролем не изменилась, однако в этом случае рестрикция всех образцов ДНК была не полной (рис. 2В). Однако при значениях рН 7,4 по сравнению с контролем способность HinfI рестрицировать ампликоны понижается (рис. 2Б).

 

рН 8,3

рН 7,4

рН 9,4

ДНК

Рестрикт

ДНК

Рестрикт

ДНК

Рестрикт

К1   2   3

К 1   2   3

К  1   2   3

К   1  2  3

К   1   2  3

К   1    2    3

днк+хс июль 1

                                                                 А                                             Б                                     В

Рис. 2. Электрофореграмма геля с ДНК и рестриктами

(К – контроль (проба без холестерина); 1 – соотношение ДНК:ХС – 1:3; 2 – соотношение ДНК:ХС – 1:6; 3 – соотношение ДНК:ХС – 1:9)

 

Таким образом, рестриктаза режет комплекс ДНК-ХС по сайтам рестрикции с разной эффективностью в слабощелочной и сильнощелочной средах.

По-видимому, при снижении величины отрицательного заряда ДНК, сродство ХС к олигонуклеотидам ДНК возрастает, а образующийся устойчивый комплекс ДНК-ХС подвергается рестрикции в меньшей степени. При смещении рН в щелочную область величина отрицательного заряда олигонуклеотидов возрастает, вследствие чего сродство ХС к ДНК уменьшается.

            Известно, что при действии повышенных температур в щелочной среде ДНК начинает разворачиваться, расплетаться. В клетке хроматиновая ДНК тоже локально расплетается при генетических процессах, в результате чего изменяется величина отрицательного заряда, что может выступать фактором изменения сродства биомолекул, в частности, холестерина к определенным нуклеотидным последовательностям и играть регуляторную роль, по крайней мере, изменяя чувствительность к действию ферментов, в том числе к нуклеазам.

Рецензенты:

Ерофеев В.И., д.б.н., профессор, проректор по учебной и методической работе ФГБОУ ДПОС «Мордовский институт переподготовки кадров агробизнеса», г. Саранск;

Шубина О.С., д.б.н., профессор, зав. кафедрой биологии, географии и методик обучения ФГБОУ ВПО «МГПИ им. М.Е. Евсевьева», г. Саранск.

 


Библиографическая ссылка

Сидоров Д.И., Трофимов В.А. ТЕОРЕТИЧЕСКОЕ И ЭКСПЕРИМЕНТАЛЬНОЕ ОБОСНОВАНИЕ ВЛИЯНИЯ ХОЛЕСТЕРИНА НА ФУНКЦИОНАЛЬНУЮ АКТИВНОСТЬ ДНК // Современные проблемы науки и образования. – 2015. – № 6. ;
URL: https://science-education.ru/ru/article/view?id=23194 (дата обращения: 22.09.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074