Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

MOLECULAR-GENETIC ANALYSIS OF REPAIR (APEX1, XPD) AND CELL CYCLE CONTROL SYSTEMS’ (CHEK2, P53) GENE EXPRASSION FOR MISCARRIAGE

Kutsyn K.A. 1 Kovalenko K.A. 1 Mashkina E.V. 1 Shkurat T.P. 1
1 Southern Federal University
The early stages of embryonic development are based on the mechanisms that underlie the functioning of several functional groups of proteins and genes encoding them. However, these mechanisms are not studied sufficiently, which significantly complicates the understanding of the laws of interaction of different cell types, individual body systems and the formation of his reactions. During the first trimester of pregnancy, there is an active cell division and fetal cytotrophoblast. Alterations in the expression of genes, involved in the checkpoints and apoptosis, effect on the embryo viability. In this study, we assessed the distribution of repair (APEX1 (MIM*107748), XPD (MIM*126340) and cell cycle control system СНЕК2 (MIM*604373), P53 (MIM*191170). Estimation of expression level of analyzed genes was performed by RT-qPCR method. In the issue of chorionic tissue analysis decreasing of XPD gene expression level was revealed in comparison to normal pregnancy course (р = 0,003). In miscarriage decidual cells in tissue level expression СНЕК2 lower compared with corresponding samples of chorionic tissue (p = 0,039). Expression level of analyzed genes is lower in the decidua then in the chorion both normal and pathological pregnancy (р = 0,01).
cell cycle control
repair system
gene expression
miscarriage

Введение

Синтез и репарация ДНК, так же как и метилирование ДНК, являются важнейшими процессами в ходе гаметогенеза, оплодотворения и беременности [3]. Ключевыми событиями в ходе раннего эмбриогенеза являются активация эмбрионального генома, т.е. переход с материнского паттерна экспрессии генов, установившегося в ооцитах, к профилю экспрессии генов собственно эмбриона, формирование бластоцисты и успешная имплантация [1]. Для последней необходимы как полноценная подготовка рецептивного эндометрия, так и поддержание жизнеспособности эмбриона. В период раннего эмбриогенеза, уровень экспрессии генов различается в тканях матери и плода и зависит от конкретного этапа развития зародыша [2]. На ранних стадиях развития эмбриона наблюдается очень небольшой уровень синтеза мРНК. Эти ранние стадии развития контролируются продуктами оогенеза и материнским геномом, что говорит о преимущественной зависимости раннего эмбриогенеза от того, что экспрессируется материнским геномом.

Исследование уровней экспрессии генов системы репарации и контроля клеточного цикла в ооцитах и предимплатационных эмбрионах на всех стадиях развития выявило их ключевую роль в нормальном эмбриональном развитии. На настоящий момент аллельный полиморфизм генов системы репарации и контроля клеточного цикла подробно рассмотрен при изучении этиологии и патогенеза различных раковых заболеваний. В то же время вовлеченность аллельных вариантов данных генов в развитие патологии беременности практически не исследована. Однако в течение первого триместра беременности происходит активное деление как фетальных, так и материнских клеток, при этом неизбежно возникновение ошибок, которые в норме исправляются системой контроля повреждений ДНК (DDR – dna damage response). Очевидно, что наличие аллельных вариантов генов системы репарации и контроля клеточного цикла посредством снижения функциональной активности BER/NER-репарационных белков и специфических протеинкиназ может внести немалый вклад в развитие патологии беременности вследствие несрабатывания механизма корректировки повреждений ДНК, появления геномной нестабильности и запуска апоптоза в материнских и фетальных клетках. В результате происходит недостаточная децидуализация стромы эндометрия, способствующая неполной или слабой инвазии цитотрофобласта, что подавляет нормальные гестационные изменения в маточно-плацентарных артериях и приводит к снижению кровотока в них. Любые изменения интенсивности экспрессии генов и выполняемых ими функций приведут к нарушению процессов эмбриогенеза и возникновению патологии беременности [5]. Целью данной работы было исследовать уровень экспрессии генов системы репарации и контроля клеточного цикла при невынашивании беременности.

Материал и методы исследования

Для молекулярно-генетического исследования использовали образцы децидуальной и хорионической тканей, полученные при медицинском аборте у женщин с физиологическим течением беременности на сроке 6-10 недель (12 образцов), а также при невынашивании беременности (10 образцов) раннего срока. У женщин, включенных в исследуемые группы, были исключены анатомические и гормональные аномалии. Все женщины подписали информированное согласие об участии в исследовании.

Выделение тотальной РНК из образцов тканей материнского и зародышевого происхождения проводили экстракцией смесью гуанидинтиоционат-фенол-хлороформ. Реакцию обратной транскрипции проводили при температуре 45° С в течение 50 минут. Затем следовала инактивация MMLV-RT при 92° С в течение 8 минут. Уровень экспрессии генов APEX1 (MIM*107748), XPD (MIM*126340), СНЕК2 (MIM*604373), P53 (MIM*191170) в децидуальной и хорионической тканях при физиологически протекающей беременности и при невынашивании беременности первого триместра определяли с помощью real-time PCR с использованием флуоресцентных ген-специфичных зондов. Подбор праймеров и зондов к мРНК исследуемых генов проводили с помощью программы Primer3 (http://frodo.wi.mit.edu/primer3/), которые в дальнейшем были синтезированы фирмой Синтол (Москва) (табл. 1). Реакцию амплификации проводили в двух повторах для каждого образца по следующей программе: 94° С – 10 минут, 60° С – 50 секунд, 94° С – 15 секунд. Последние два шага повторяли 40 раз.

Таблица 1 – Характеристика праймеров и зондов, используемых для определения уровня экспрессии генов цитокинов

Ген

5-3` последовательность праймеров и зонда

GAPDH

AGGTCGGAGTCAACGGATTT

ATCGCCCCACTTGATTTTGG

Fam-GGCGCCTGGTCACCAGGGCT-BHQ1

АРЕХ1

AAAGTTTCTTACGGCATAGGCGAT

CTGTTACCAGCACAAACGAGTCA

Fam-ATCACCCGGCCTTCCTGATCATGCTCC-ВHQ1

P53

GCCCTCAACAAGATGTTTTGCCAACT

CAACCTCCGTCATGTGCTGTGACTG

Fam-TTGATTCCACACCCCCGCCCGGCACC-BHQ1

XPD

CGAGGCCCACAACATTGACAAC

TCTTTGATCCTGAGCACCGTCT

Fam-AACCTCACCCGCCGGACCCTTGACC-BHQ1

CHEK2

AGCCCAGCCTTCTACTAGTCGAAA

GTTCAAACCACGGAGTTCACAACACA

Fam-TCGGCACCCTCGGCTTCCCCTTCACGG-BHQ1

Статистический анализ результатов исследования уровня экспрессии генов, проводили методом 2-∆∆Ct. Для сравнения уровня экспрессии генов использовали все значения экспрессии гена (∆Ct) и сравнивали их между собой как две выборки. Для подтверждения достоверности отличий экспрессии гена в совокупности одной из выборок образцов по сравнению с другой выборкой использовали критерий Стьюдента.

Результаты исследования и их обсуждение

В целом, в норме в клетках децидуальной ткани уровень экспрессии АРЕХ1 выше по сравнению с соответствующими образцами хорионической ткани (Р = 0,013) (рис. 1А). При нарушении ранних этапов эмбриогенеза активность транскрипции гена АРЕХ1 в клетках хорионической ткани приблизительно на одном уровне с децидуальной. В целом, уровень экспрессии данного гена в тканях материнского и зародышевого происхождения при патологии беременности не отличается от такового для физиологически протекающей беременности (рис. 1Б).

АБ

Рис. 1. Уровень экспрессии гена АРЕХ1 в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при физиологически протекающей беременности (А) и невынашивании беременности (Б).

Уровень экспрессии гена XPD в децидуальной ткани при физиологически протекающей беременности в среднем в 2,5 раза (Р = 0,0001) превосходит данный показатель в хорионической ткани (рис. 2А). При невынашивании беременности – в 1,5 раза (Р = 0,003) (рис. 2Б). Экспрессия данного гена в децидуальной ткани при невынашивании беременности выше по сравнению с физиологически протекающей беременности (Р = 0,003). В хорионической ткани уровень мРНК XPD одинаков при обоих вариантах течения беременности.

АБ

Рис. 2. Уровень экспрессии гена XPD в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при физиологически протекающей беременности (А) и невынашивании беременности (Б).

В целом, в норме в клетках децидуальной ткани уровень экспрессии CHEK2 выше, по сравнению с соответствующими образцами хорионической ткани (Р = 0,0001) (рис. 3А). При невынашивании беременности в клетках децидуальной ткани уровень экспрессии CHEK2 выше по сравнению с соответствующими образцами хорионической ткани (P = 0,039) (рис. 3Б).

АБ

Рис. 3. Уровень экспрессии гена CHEK2 в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при физиологически протекающей беременности (А) и невынашивании беременности (Б).

Уровень экспрессии гена р53 выше в децидуальной ткани по сравнению с хорионической при физиологическом (Р = 0,0001) течении беременности (рис. 4А). При невынашивании беременности различий в уровне экспрессии гена р53 между двумя типами тканей не выявлено (P = 0,19) (рис. 4Б).

АБ

Рис. 4. Уровень экспрессии гена р53 в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при физиологически протекающей беременности (А) и невынашивании беременности (Б).

В целом, уровень экспрессии всех исследованных нами генов репарации (эндонуклеазы и хеликазы) в тканях материнского происхождения выше (P = 0,01), чем в хорионической. Возможно, это связано с тем, что при децидуализации эндометрия запускается эндоредупликация, во время которой подавляются механизмы АТМ-CHEK2-P53 опосредованного апоптоза за счет сайленсинга промоторов проапоптотических генов. Показано, что гиперэкспрессия р53 не индуцирует запуск апоптоза в эндоредуплицирующихся клетках, в отличие от клеток с обычным митотическим циклом. Кроме того, клетки в состоянии эндоциклического деления не вступают в апоптоз за счет измененного чекпоинт ответа на генотоксический стресс [7].

По данным литературы известно, что в ответ на повреждения ДНК CHEK2 фосфорилирует p53, который в свою очередь активирует р21, который запускает р53 – опосредованную остановку клеточного цикла в G1-фазе. Кроме того, было показано, что р53 подавляет экспрессию АРЕХ1, обеспечивая тем самым дополнительный р53 – опосредованный путь индукции апоптоза в ответ на повреждения ДНК [8]. APEX1 в свою очередь может выполнять роль как ко-активатора, так и ко-репрессора гена р21, в зависимости от р53 статуса. Вероятно, что репрессия АРЕХ1 и гиперэкспрессия р53 способны стимулировать эндоредупликацию клеток трофобласта и децидуа за счет активации ингибитора циклин-зависимых киназ р21 [8].

Процесс образования специализированных клеток децидуа – ключевой для развития беременности. В начале децидуализации стромальные клетки, непосредственно окружающие имплантируемую бластоцисту, активно делятся. Клеточный цикл осуществляется за счет работы циклин-зависимых киназ. Во время деления клеток эндометрия белок p21 подавляет работу комплекса циклина D и киназы cdk4, что приводит к образованию эндоцикла (удвоению хромосом без деления). В результате эндоредупликации получаются гигантские полиплоидные клетки децидуа (до 64n) [5].

Изменение уровня экспрессии генов АТМ – CHEK2 сигнального пути (CHEK2) приводит к изменению функциональной активности генов системы репарации (APEX1, XPD), контроля клеточного цикла и апоптоза (р53). Р53 в свою очередь индуцирует экспрессию генов, регулирующих имплантацию и плацентацию регулятор LIF и белок р21, запускающий процесс эндоредупликации в эндометрии, а также ХГЧ, участвующий в плацентации посредством стимуляции роста сосудов [6].

Полученные результаты можно объяснить тем, что в процессе эндоредупликации децидуальных клеток подавляется р53– опосредованный путь апоптоза. Кроме того, в клетках трофобласта, дифференцирующихся в эндоредуплицирующиеся клетки, индукция р21 приводит к подавлению Cdk1 и к подавлению работы чекпоинт пунктов и возникновению толерантности к повреждениям ДНК [5]. Исследование уровней экспрессии генов системы репарации и контроля клеточного цикла в ооцитах и предымплатационных эмбрионах на всех стадиях развития выявило их ключевую роль в нормальном эмбриональном развитии. Изменение экспрессии генов, участвующих в чекпоинтах и запуске апоптоза, оказывает влияние на жизнеспособность эмбриона.

Работа выполнена при финансовой поддержке РФФИ, проект № 12-04-31408.

Рецензенты:

Амелина С.С., д.м.н., заведующая отделом биомедицины НИИ биологии Южного федерального университета, г. Ростов-на-Дону.

Усатов А.В., д.б.н., профессор, заведующий отделом изменчивости генома НИИ биологии Южного федерального университета, г. Ростов-на-Дону.