Сетевое издание
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

ЭКСПРЕССИЯ ГЕНОВ СИСТЕМЫ РЕПАРАЦИИ (APEX1, XPD) И КОНТРОЛЯ КЛЕТОЧНОГО ЦИКЛА (CHEK2, P53) ПРИ ПАТОЛОГИИ БЕРЕМЕННОСТИ

Куцын К.А. 1 Коваленко К.А. 1 Машкина Е.В. 1 Шкурат Т.П. 1
1 ФГАОУ ВПО «Южный федеральный университет»
Изменение экспрессии генов, участвующих в сверочных точках клеточного цикла и запуске апоптоза оказывает влияние на жизнеспособность эмбриона. Проведено исследование уровней экспрессии генов системы репарации и контроля клеточного цикла: APEX1 (MIM*107748), XPD (MIM*126340), СНЕК2 (MIM*604373), P53 (MIM*191170). Уровень экспрессии исследуемых генов в децидуальной и хорионической ткани при физиологически протекающей беременности и при невынашивании беременности первого триместра был проанализирован с помощью RT-qPCR метода. Уровень экспрессии всех исследованных нами генов в децидуальной ткани несколько выше по сравнению с хорионической как в норме, так и при неразвивающейся беременности (р = 0,01). В результате исследования выявлено повышение уровня экспрессии гена XPD в децидуальной ткани при невынашивании беременности по сравнению с нормально протекающей беременностью (р = 0,003). При невынашивании беременности в клетках децидуальной ткани уровень экспрессии СНЕК2 ниже по сравнению с соответствующими образцами хорионической ткани (р = 0,039).
контроль клеточного цикла
система репарации
экспрессия гена
невынашивание беременности
1. Altmeae S. et al. Research Resource: Interactome of Human Embryo Implantation: Identification of Gene Expression Pathways, Regulation, and Integrated Regulatory Networks / Altmeae S., Reimand J.E., Hovatta O., Pu Zhang, et al. // Mol Endocrinol. 2012. – 26(1). – P. 203–217.
2. Assou S. et al. Dynamic changes in gene expression during human early embryo development: from fundamental aspects to clinical applications / Assou S., Boumela I., Haouzi D., Anahory T., Dechaud H., Vos J., and Hamamah S. // Human Reproduction Update. 2011. – Vol.17. - No.2. – P. 272–290.
3. Assou S. et al. Transcriptome Analysis during Human Trophectoderm Specification Suggests New Roles of Metabolic and Epigenetic Genes / Assou S, Boumela I, Haouzi D, Monzo C, Dechaud H, et al. // Plos ONE. 2012. – 7(6): e39306.
4. Dey S.K. Molecular Cues to Implantation / Dey S.K., Lim H., Das S.K., Reese J., Paria B.C., Daikoku T., Wang H. // Endocr. Rev. 2004. – 25. – P. 341–373.
5. Fox D.T. and Duronio R. Endoreplication and polyploidy: insights into development and disease / Fox D. T., Duronio R. // Development. 2013. – 140. – P. 3-12.
6. Hu W. et al. Regulation of Fertility by the p53 Family Members /Hu W., Zheng T., Wang J. // Genes Cancer. 2011. – 2. – P. 420–430.
7. Mehrotra S. et al. Endocycling cells do not apoptose in response to DNA rereplicationgenotoxic stress / Mehrotra S., Maqbool S., Kolpakas A., Murnen K., Calvi B. // Genes & development. 2008. – 22. – P. 3158–3171.
8. Sengupta S. et al. Dual Regulatory Roles of Human AP-Endonuclease (APE1/Ref-1) in CDKN1A/p21 Expression / Sengupta S., Mitra S., Bhakat K. // PLoS ONE 8(7):e68467.
9. Zaky A. et al. Regulation of the human AP-endonuclease (APE1/Ref-1) expression by the tumor suppresso p53 in response to DNA damage / Zaky A., Busso C., Izumi T., Chattopadhyay R., Bassiouny A., Mitra S., Bhakat K. // Nucleic Acids Research. 2008. – Vol. 36. - No. 5. – P. 1555–1566.

Введение

Синтез и репарация ДНК, так же как и метилирование ДНК, являются важнейшими процессами в ходе гаметогенеза, оплодотворения и беременности [3]. Ключевыми событиями в ходе раннего эмбриогенеза являются активация эмбрионального генома, т.е. переход с материнского паттерна экспрессии генов, установившегося в ооцитах, к профилю экспрессии генов собственно эмбриона, формирование бластоцисты и успешная имплантация [1]. Для последней необходимы как полноценная подготовка рецептивного эндометрия, так и поддержание жизнеспособности эмбриона. В период раннего эмбриогенеза, уровень экспрессии генов различается в тканях матери и плода и зависит от конкретного этапа развития зародыша [2]. На ранних стадиях развития эмбриона наблюдается очень небольшой уровень синтеза мРНК. Эти ранние стадии развития контролируются продуктами оогенеза и материнским геномом, что говорит о преимущественной зависимости раннего эмбриогенеза от того, что экспрессируется материнским геномом.

Исследование уровней экспрессии генов системы репарации и контроля клеточного цикла в ооцитах и предимплатационных эмбрионах на всех стадиях развития выявило их ключевую роль в нормальном эмбриональном развитии. На настоящий момент аллельный полиморфизм генов системы репарации и контроля клеточного цикла подробно рассмотрен при изучении этиологии и патогенеза различных раковых заболеваний. В то же время вовлеченность аллельных вариантов данных генов в развитие патологии беременности практически не исследована. Однако в течение первого триместра беременности происходит активное деление как фетальных, так и материнских клеток, при этом неизбежно возникновение ошибок, которые в норме исправляются системой контроля повреждений ДНК (DDR – dna damage response). Очевидно, что наличие аллельных вариантов генов системы репарации и контроля клеточного цикла посредством снижения функциональной активности BER/NER-репарационных белков и специфических протеинкиназ может внести немалый вклад в развитие патологии беременности вследствие несрабатывания механизма корректировки повреждений ДНК, появления геномной нестабильности и запуска апоптоза в материнских и фетальных клетках. В результате происходит недостаточная децидуализация стромы эндометрия, способствующая неполной или слабой инвазии цитотрофобласта, что подавляет нормальные гестационные изменения в маточно-плацентарных артериях и приводит к снижению кровотока в них. Любые изменения интенсивности экспрессии генов и выполняемых ими функций приведут к нарушению процессов эмбриогенеза и возникновению патологии беременности [5]. Целью данной работы было исследовать уровень экспрессии генов системы репарации и контроля клеточного цикла при невынашивании беременности.

Материал и методы исследования

Для молекулярно-генетического исследования использовали образцы децидуальной и хорионической тканей, полученные при медицинском аборте у женщин с физиологическим течением беременности на сроке 6-10 недель (12 образцов), а также при невынашивании беременности (10 образцов) раннего срока. У женщин, включенных в исследуемые группы, были исключены анатомические и гормональные аномалии. Все женщины подписали информированное согласие об участии в исследовании.

Выделение тотальной РНК из образцов тканей материнского и зародышевого происхождения проводили экстракцией смесью гуанидинтиоционат-фенол-хлороформ. Реакцию обратной транскрипции проводили при температуре 45° С в течение 50 минут. Затем следовала инактивация MMLV-RT при 92° С в течение 8 минут. Уровень экспрессии генов APEX1 (MIM*107748), XPD (MIM*126340), СНЕК2 (MIM*604373), P53 (MIM*191170) в децидуальной и хорионической тканях при физиологически протекающей беременности и при невынашивании беременности первого триместра определяли с помощью real-time PCR с использованием флуоресцентных ген-специфичных зондов. Подбор праймеров и зондов к мРНК исследуемых генов проводили с помощью программы Primer3 (http://frodo.wi.mit.edu/primer3/), которые в дальнейшем были синтезированы фирмой Синтол (Москва) (табл. 1). Реакцию амплификации проводили в двух повторах для каждого образца по следующей программе: 94° С – 10 минут, 60° С – 50 секунд, 94° С – 15 секунд. Последние два шага повторяли 40 раз.

Таблица 1 – Характеристика праймеров и зондов, используемых для определения уровня экспрессии генов цитокинов

Ген

5-3` последовательность праймеров и зонда

GAPDH

AGGTCGGAGTCAACGGATTT

ATCGCCCCACTTGATTTTGG

Fam-GGCGCCTGGTCACCAGGGCT-BHQ1

АРЕХ1

AAAGTTTCTTACGGCATAGGCGAT

CTGTTACCAGCACAAACGAGTCA

Fam-ATCACCCGGCCTTCCTGATCATGCTCC-ВHQ1

P53

GCCCTCAACAAGATGTTTTGCCAACT

CAACCTCCGTCATGTGCTGTGACTG

Fam-TTGATTCCACACCCCCGCCCGGCACC-BHQ1

XPD

CGAGGCCCACAACATTGACAAC

TCTTTGATCCTGAGCACCGTCT

Fam-AACCTCACCCGCCGGACCCTTGACC-BHQ1

CHEK2

AGCCCAGCCTTCTACTAGTCGAAA

GTTCAAACCACGGAGTTCACAACACA

Fam-TCGGCACCCTCGGCTTCCCCTTCACGG-BHQ1

Статистический анализ результатов исследования уровня экспрессии генов, проводили методом 2-∆∆Ct. Для сравнения уровня экспрессии генов использовали все значения экспрессии гена (∆Ct) и сравнивали их между собой как две выборки. Для подтверждения достоверности отличий экспрессии гена в совокупности одной из выборок образцов по сравнению с другой выборкой использовали критерий Стьюдента.

Результаты исследования и их обсуждение

В целом, в норме в клетках децидуальной ткани уровень экспрессии АРЕХ1 выше по сравнению с соответствующими образцами хорионической ткани (Р = 0,013) (рис. 1А). При нарушении ранних этапов эмбриогенеза активность транскрипции гена АРЕХ1 в клетках хорионической ткани приблизительно на одном уровне с децидуальной. В целом, уровень экспрессии данного гена в тканях материнского и зародышевого происхождения при патологии беременности не отличается от такового для физиологически протекающей беременности (рис. 1Б).

АБ

Рис. 1. Уровень экспрессии гена АРЕХ1 в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при физиологически протекающей беременности (А) и невынашивании беременности (Б).

Уровень экспрессии гена XPD в децидуальной ткани при физиологически протекающей беременности в среднем в 2,5 раза (Р = 0,0001) превосходит данный показатель в хорионической ткани (рис. 2А). При невынашивании беременности – в 1,5 раза (Р = 0,003) (рис. 2Б). Экспрессия данного гена в децидуальной ткани при невынашивании беременности выше по сравнению с физиологически протекающей беременности (Р = 0,003). В хорионической ткани уровень мРНК XPD одинаков при обоих вариантах течения беременности.

АБ

Рис. 2. Уровень экспрессии гена XPD в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при физиологически протекающей беременности (А) и невынашивании беременности (Б).

В целом, в норме в клетках децидуальной ткани уровень экспрессии CHEK2 выше, по сравнению с соответствующими образцами хорионической ткани (Р = 0,0001) (рис. 3А). При невынашивании беременности в клетках децидуальной ткани уровень экспрессии CHEK2 выше по сравнению с соответствующими образцами хорионической ткани (P = 0,039) (рис. 3Б).

АБ

Рис. 3. Уровень экспрессии гена CHEK2 в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при физиологически протекающей беременности (А) и невынашивании беременности (Б).

Уровень экспрессии гена р53 выше в децидуальной ткани по сравнению с хорионической при физиологическом (Р = 0,0001) течении беременности (рис. 4А). При невынашивании беременности различий в уровне экспрессии гена р53 между двумя типами тканей не выявлено (P = 0,19) (рис. 4Б).

АБ

Рис. 4. Уровень экспрессии гена р53 в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при физиологически протекающей беременности (А) и невынашивании беременности (Б).

В целом, уровень экспрессии всех исследованных нами генов репарации (эндонуклеазы и хеликазы) в тканях материнского происхождения выше (P = 0,01), чем в хорионической. Возможно, это связано с тем, что при децидуализации эндометрия запускается эндоредупликация, во время которой подавляются механизмы АТМ-CHEK2-P53 опосредованного апоптоза за счет сайленсинга промоторов проапоптотических генов. Показано, что гиперэкспрессия р53 не индуцирует запуск апоптоза в эндоредуплицирующихся клетках, в отличие от клеток с обычным митотическим циклом. Кроме того, клетки в состоянии эндоциклического деления не вступают в апоптоз за счет измененного чекпоинт ответа на генотоксический стресс [7].

По данным литературы известно, что в ответ на повреждения ДНК CHEK2 фосфорилирует p53, который в свою очередь активирует р21, который запускает р53 – опосредованную остановку клеточного цикла в G1-фазе. Кроме того, было показано, что р53 подавляет экспрессию АРЕХ1, обеспечивая тем самым дополнительный р53 – опосредованный путь индукции апоптоза в ответ на повреждения ДНК [8]. APEX1 в свою очередь может выполнять роль как ко-активатора, так и ко-репрессора гена р21, в зависимости от р53 статуса. Вероятно, что репрессия АРЕХ1 и гиперэкспрессия р53 способны стимулировать эндоредупликацию клеток трофобласта и децидуа за счет активации ингибитора циклин-зависимых киназ р21 [8].

Процесс образования специализированных клеток децидуа – ключевой для развития беременности. В начале децидуализации стромальные клетки, непосредственно окружающие имплантируемую бластоцисту, активно делятся. Клеточный цикл осуществляется за счет работы циклин-зависимых киназ. Во время деления клеток эндометрия белок p21 подавляет работу комплекса циклина D и киназы cdk4, что приводит к образованию эндоцикла (удвоению хромосом без деления). В результате эндоредупликации получаются гигантские полиплоидные клетки децидуа (до 64n) [5].

Изменение уровня экспрессии генов АТМ – CHEK2 сигнального пути (CHEK2) приводит к изменению функциональной активности генов системы репарации (APEX1, XPD), контроля клеточного цикла и апоптоза (р53). Р53 в свою очередь индуцирует экспрессию генов, регулирующих имплантацию и плацентацию регулятор LIF и белок р21, запускающий процесс эндоредупликации в эндометрии, а также ХГЧ, участвующий в плацентации посредством стимуляции роста сосудов [6].

Полученные результаты можно объяснить тем, что в процессе эндоредупликации децидуальных клеток подавляется р53– опосредованный путь апоптоза. Кроме того, в клетках трофобласта, дифференцирующихся в эндоредуплицирующиеся клетки, индукция р21 приводит к подавлению Cdk1 и к подавлению работы чекпоинт пунктов и возникновению толерантности к повреждениям ДНК [5]. Исследование уровней экспрессии генов системы репарации и контроля клеточного цикла в ооцитах и предымплатационных эмбрионах на всех стадиях развития выявило их ключевую роль в нормальном эмбриональном развитии. Изменение экспрессии генов, участвующих в чекпоинтах и запуске апоптоза, оказывает влияние на жизнеспособность эмбриона.

Работа выполнена при финансовой поддержке РФФИ, проект № 12-04-31408.

Рецензенты:

Амелина С.С., д.м.н., заведующая отделом биомедицины НИИ биологии Южного федерального университета, г. Ростов-на-Дону.

Усатов А.В., д.б.н., профессор, заведующий отделом изменчивости генома НИИ биологии Южного федерального университета, г. Ростов-на-Дону.


Библиографическая ссылка

Куцын К.А., Коваленко К.А., Машкина Е.В., Шкурат Т.П. ЭКСПРЕССИЯ ГЕНОВ СИСТЕМЫ РЕПАРАЦИИ (APEX1, XPD) И КОНТРОЛЯ КЛЕТОЧНОГО ЦИКЛА (CHEK2, P53) ПРИ ПАТОЛОГИИ БЕРЕМЕННОСТИ // Современные проблемы науки и образования. – 2013. – № 6. ;
URL: https://science-education.ru/ru/article/view?id=11592 (дата обращения: 03.12.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074