Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,813

ANALYSIS OF IL10 GENE EXPRESSION IN DECIDUAL AND CHORIONIC TISSUES AT PREGNANCY LOSS

Mashkina E.V. 1 Kovalenko K.A. 1 Miktadova A.V. 1 Volosovtsova G.I. 1 Saraev K.N. 1
1 Southern Federal University
Дисрегуляция в функционировании цитокинов, в том числе обусловленная генотипом, может быть негативным фактором для протекания ранних этапов эмбриогенеза человека. IL-10 является ключевым регулятором иммунного ответа, который ингибирует секрецию провоспалительных цитокинов. В работе проанализирована частота регистрации полиморфного варианта -819C-T гена IL-10 в клетках хорионической и децидуальной тканей при невынашивании беременности первого триместра. Различий в частотах генотипов и аллелей по сравнению с контролем не выявлено. Однако при неразвивающейся беременности уровень экспрессии гена IL-10 в децидуальной ткани статистически значимо выше по сравнению с децидуальной и хорионической тканями при физиологически развивающейся беременности. Поскольку цитокины являются медиаторами межклеточных взаимодействий, изменение характера функционирования генов цитокиновой сети влечет за собой изменение в регуляции экспрессии и функционировании целого ряда метаболических каскадов.
Deregulation of the cytokine functional network is a risk factor of early pregnancy disorders. IL-10 is a key regulator of the immune response that inhibits the secretion of proinflammatory cytokines. In this work the frequency of registration of polymorphism -819C-T gene IL-10 was analyzed in the cells of the decidua and chorionic tissue miscarriage in the first trimester. The differences in allele and genotype frequencies were compared with the control is not revealed. However, the level of IL-10 gene expression in the decidual tissue was significantly higher at pregnancy loss with comparison to the decidua and chorionic tissues at physiological developing pregnancy. Since cytokines are mediators of cell-cell interactions change in the functioning of genes cytokine network involves a change in the regulation of expression and function of a number of metabolic cascades.
pregnancy loss
expression
gene polymorphism
IL-10

Введение

Цитокины как молекулы межклеточной сигнализации играют важнейшую роль на ранних этапах эмбрионального развития человека, обеспечивая образование и рост плаценты, ангиогенез, иммунотолерантность материнского организма. Основные продуценты цитокинов - имуннокомпетентные клетки - локализованы во всех органах генитального тракта женщины - яичниках, эндометрии матке, влагалище. Кроме того, цитокины во время беременности секретируются самим эмбрионом. При инвазии трофобласта происходит активация клеток иммунной системы, что приводит к синтезу целого спектра цитокинов. В случае преобладания Th1 цитокинов возможно нарушение деления и дифференцировки клеток плаценты и эмбриона, отторжение трансплантанта [6; 11]. Th2 цитокины синтезируют IL-4, IL-5, IL-10 и другие интерлейкины, обеспечивающие преимущественно гуморальные реакции, гемопоэз, ангиогенез, ангиогенез в децидуальной ткани и трофобласте. Предполагается, что после оплодотворения в зиготе синтезируются сигнальные молекулы, опосредующие активный внутриутробный синтез Th2 клеток [9].

Процессы формирования сосудистой сети и становления маточно-плацентарного кровотока являются ключевыми событиями, необходимыми для обеспечения основной функции плаценты - обмена кислородом и питательными веществами между организмами матери и плода. Факторы ангиогенеза (в том числе соcудисто-эндотелиальные, эпидермальные, инсулиноподобные, а также ряд интерлейкинов) начинают продуцировать на ранних этапах роста плода еще до начала процессов образования новых сосудов, формирования плаценты и ремоделирования материнских артерий. Помимо регуляции ангиогенеза, большинство этих факторов контролирует процессы дифференцировки пролиферации клеток, что проявляется в их влиянии на процессы инвазии трофобласта.

Риск потери плода может быть обусловлен изменением функциональной активности цитокинов, опосредующих иммунный ответ материнского организма на развивающийся плод [2; 8]. Дисрегуляция в функционировании цитокинов, в том числе обусловленная генотипом, может быть негативным фактором для протекания ранних этапов эмбриогенеза человека [5]. Целью данной работы было исследовать ассоциацию между полиморфизмом и уровнем экспрессии гена IL-10 и невынашиванием беременности в I триместре.

Материал и методы исследования

Для молекулярно-генетического исследования использовали образцы децидуальной и хорионической тканей, полученные при медицинском аборте у женщин с физиологическим течением беременности на сроке 6 - 11 недель (25 образцов), а также при спонтанном аборте и неразвивающейся беременности (33 образца) раннего срока. У женщин, включенных в исследуемые группы, были исключены анатомические и гормональные аномалии. Все женщины подписали информированное согласие об участии в исследовании.

Для выделения ДНК из тканей использовали фенол-хлороформный метод. Выделение тотальной РНК из образцов тканей материнского и зародышевого происхождения проводили экстракцией смесью гуанидинтиоционат-фенол-хлороформ.

Полиморфизм -819C-T гена IL-10 (MIM *124092) исследовали с использованием набора реагентов SNP-экспресс («Литех», Москва). Анализ основан на проведении реакций амплификации с двумя парами аллель-специфичных праймеров. Разделение продуктов амплификации проводили методом горизонтального электрофореза в 3%-ном агарозном геле. Анализ электрофореграмм проводили на трансиллюминаторе GelDoc (BioRad).

Для проведения реакции обратной транскрипции использовали набор реагентов компании «Синтол» (Москва). Реакцию обратной транскрипции проводили при температуре 45 °С в течение 50 минут. Затем следовала инактивация MMLV-RT при 92 °С в течение 8 минут. Уровень экспрессии гена IL-10 определяли с помощью real-time PCR с использованием флуоресцентных ген-специфичных зондов. Последовательность праймеров и зондов приведена в таблице 1. Реакцию амплификации проводили в двух повторах для каждого образца по следующей программе: 94 °С - 10 минут, 60 °С - 50 секунд, 94 °С - 15 секунд. Последние два шага повторяли 40 раз.

Таблица 1 – Характеристика праймеров и зондов, используемых для определения уровня экспрессии генов цитокинов

Ген

5`-3` последовательность праймеров и зонда

 

GAPDH

AGGTCGGAGTCAACGGATTT

ATCGCCCCACTTGATTTTGG

Fam-GGCGCCTGGTCACCAGGGCT-BHQ1

 

IL-10

ACGGCGCTGTCATCGATT

GGCATTCTTCACCTGCTCCA

Fam-CTTCCCTGTGAAAACAAGAGCAAGGCC-BHQ1

Статистический анализ полученных данных проводили с помощью программного пакета MS Excel. Соответствие распределения частот генотипов равновесию Харди-Вайнберга определяли по стандартным формулам. Оценку различий в распределении полиморфных вариантов генов в обследованных группах осуществляли по критерию χ2 при помощи программы BIOSTAT.

Статистический анализ результатов изучения уровня экспрессии генов проводили методом 2-∆∆Ct. Для сравнения уровня экспрессии генов использовали все значения экспрессии гена (∆Ct) и сравнивали их между собой как две выборки. Для подтверждения достоверности отличий экспрессии гена в совокупности одной из выборок образцов по сравнению с другой выборкой использовали критерий Стьюдента.

Результаты исследования и их обсуждение

IL-10 является ключевым регулятором иммунного ответа, который ингибирует секрецию провоспалительных цитокинов Th1-типа лимфоцитами и активированными макрофагами. В децидуальной и хорионической ткани при физиологической беременности количество гетерозиготных носителей полиморфного варианта гена IL-10 и гомозигот по аллели -819С одинаково (табл. 2). При невынашивании беременности доля гомозигот -819СС в децидуальной ткани составила 60%. Однако статистически значимых различий в частотах генотипов и аллелей между двумя сравниваемыми группами не выявлено. То же самое справедливо и для хорионической ткани (табл. 2).

Данные литературы о возможной связи между наличием исследуемого полиморфизма гена IL-10 и риском нарушения ранних этапов эмбриогенеза человека противоречивы. Одни авторы [2; 7; 8; 12] считают, что наличие полиморфизмов -592А, -819Т, -1082А промоторного участка гена IL-10 не ассоциировано с повышенным риском невынашивания беременности. А в исследованиях Costeas и его коллег [4] выявлена связь между данными тремя полиморфизмами и повышением риска спонтанного прерывания беременности. В ряде исследований показана важность анализа не отдельных полиморфизмов, а гаплотипов. В частности, «GCC» гаплотип (G в позиции -1082, C в позиции -819 и С в положении -592), индуцирующий высокий уровень транскрипции IL-10, связан с риском преждевременного разрыва околоплодной оболочки и преждевременными родами [1].

Таблица 2 - Частота генотипов (%) и аллелей по полиморфизму -819 C-Т гена IL-10 в хорионической и децидуальной тканях при невынашивании беременности

Генотип

Контроль, абс (%)

НБ, абс. (%)

OR (95% CI)

χ2 (P)

Хорионическая ткань

CC

10 (43,5%)

17 (51,5%)

1,38 (0,47 – 4,03

 

3,05 (0,22)

CT

11 (47,8%)

16 (48,5%)

1,03 (0,35 – 2,98)

TT

2 (8,7%)

0

0,13 (0,05 – 2,81)

Частота аллели -819Т

0,326

0,242

0,66 (0,29 – 1,52)

0,95 (0,33)

Децидуальная ткань

CC

12 (48,0%)

20 (60,6%)

1,67 (0,58 – 4,76)

 

3,12 (0,21)

CT

11 (44,0%)

13 (39,4%)

0,83 (0,29 – 2,37)

TT

2 (8,0%)

0

0,14 (0,01 – 3,06)

Частота аллели -819Т

0,3

0,197

0,57 (0,24 – 1,35)

1,65 (0,2)

Примечание: МА – медицинский аборт; НБ – невынашивание беременности

Анализ уровня экспрессии гена IL-10 показал, что при физиологически развивающейся беременности уровень мРНК гена IL-10 в децидуальной ткани не отличается от такового в хорионической ткани (рис. 1).

Рисунок 1 - Уровень экспрессии гена IL-10 в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при физиологически развивающейся беременности (А – децидуальная ткань; В – хорионическая ткань).

При неразвивающейся беременности уровень экспрессии гена IL-10 в децидуальной ткани статистически значимо выше по сравнению с показателем контроля (Р = 0,019) (рис. 2), а также по сравнению с хорионической тканью при неразвивающейся беременности (Р = 0,036) (рис. 3).

Рисунок 2 - Уровень экспрессии гена IL-10 в клетках децидуальной ткани относительно экспрессии гена GAPDH (А – физиологическое течение беременности; В – неразвивающаяся беременность).

Рисунок 3 - Уровень экспрессии гена IL-10 в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при неразвивающейся беременности (А – децидуальная ткань; В – хорионическая ткань).

Известно, что IL-10 принимает активное участие в обеспечении иммунотолерантности материнского организма к развивающемуся зародышу. Кроме того, IL-10 обеспечивает снижение уровня экспрессии децидуальными клетками ряда молекул – активаторов коагуляции [3]. Чрезмерная продукция цитокинов Th2 может сопровождаться неограниченной инвазией трофобласта. Таким образом, отклонение экспрессии гена IL-10 от оптимального уровня может обуславливать нарушение ранних этапов эмбриогенеза человека.

Анализ экспрессии 24500 генов в децидуальной ткани женщин с привычным невынашиванием беременности с использованием Illumina Ref-8 чипа выявил 155 генов, уровень экспрессии которых более чем в 2 раза отличается от контрольного [10]. При этом 23% среди них являются генами иммунного ответа. Доля других функциональных групп генов не превышает 18% [10]. Поскольку цитокины являются медиаторами межклеточных взаимодействий, изменение характера функционирования генов цитокиновой сети влечет за собой изменение в регуляции экспрессии и функционировании целого ряда метаболических каскадов. При изменении концентраций про- и противовоспалительных цитокинов возможно значительное повышение количества апоптических клеток и нарушение функционирования трофобласта в целом.

Рецензенты:

Амелина Светлана Сергеевна, доктор медицинских наук, заведующая отделом биомедицины НИИ биологии Южного федерального университета, г. Ростов-на-Дону.

Усатов Александр Вячеславович, доктор биологических наук, профессор, заведующий отделом изменчивости генома НИИ биологии Южного федерального университета, г. Ростов-на-Дону.