Электронный научный журнал
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,791

АНАЛИЗ ЭКСПРЕССИИ ГЕНА IL-10 В ДЕЦИДУАЛЬНОЙ И ХОРИОНИЧЕСКОЙ ТКАНЯХ ПРИ НЕВЫНАШИВАНИИ БЕРЕМЕННОСТИ

Машкина Е.В. 1 Коваленко К.А. 1 Миктадова А.В. 1 Волосовцова Г.И. 1 Сараев К.Н. 1
1 ФГАОУ ВПО «Южный федеральный университет»
Дисрегуляция в функционировании цитокинов, в том числе обусловленная генотипом, может быть негативным фактором для протекания ранних этапов эмбриогенеза человека. IL-10 является ключевым регулятором иммунного ответа, который ингибирует секрецию провоспалительных цитокинов. В работе проанализирована частота регистрации полиморфного варианта -819C-T гена IL-10 в клетках хорионической и децидуальной тканей при невынашивании беременности первого триместра. Различий в частотах генотипов и аллелей по сравнению с контролем не выявлено. Однако при неразвивающейся беременности уровень экспрессии гена IL-10 в децидуальной ткани статистически значимо выше по сравнению с децидуальной и хорионической тканями при физиологически развивающейся беременности. Поскольку цитокины являются медиаторами межклеточных взаимодействий, изменение характера функционирования генов цитокиновой сети влечет за собой изменение в регуляции экспрессии и функционировании целого ряда метаболических каскадов.
неразвивающаяся беременность
невынашивание беременности
экспрессия гена
полиморфизм гена
IL-10
1. Annells MF. Interleukins-1-4-6-10, tumor necrosis factor, transforming growth factor-beta, FAS, and mannose-binding protein C gene polymorphisms in Australian women: Risk of preterm birth / Annells MF, Hart PH, Mullighan CG et al // Am J Obstet Gynecol. - 2004. - V. 191. - P. 2056–2067.
2. Bombell S. Cytokine polymorphisms in women with recurrent pregnancy loss: meta-analisis / Bombell S., McGuire W. // Aust NZJ Obstet Gynaecol. - 2008. - V. 48. - P. 147-154.
3. Cochery-Nouvellon E. Interleukin 10 gene promoter polymorphisms in women with pregnancy loss: preferential association with embryonic wastage / Cochery-Nouvellon E., Nguyen P, Attaoua R. et al. // Biol Reprod. - 2009. - V. 80. - P. 1115-1120.
4. Costeas P. Th2/Th3 cytokine genotypes are associated with pregnancy loss / Costeas P., Koumouli A., Giantsiou-Kyriakou A. et al. // Hum Immunol. - 2004. - V. 65. - P. 135-141.
5. Daher S. Genetic polymorphisms and recurrent spontaneous abortions: an overview of current knowledge / Daher S., Mattar R, Gueuvoghlanian-Silva BY, Torloni MR. // Am J Reprod Immunol. - 2012. - V. 67. - P. 341-347.
6. Hill JA. 3rd. Immunodystrophism: evidence for a novel alloimmune hypothesis for recurrent pregnancy loss involving Th1-type immunity to trophoblast / Hill JA. 3rd, Choi BC. // Semin Reprod Med. - 2000. - V. 18. - P. 401-405.
7. Kamali-Sarvestani E Cytokine gene polymorphisms and susceptibility to recurrent pregnancy loss in Iranian women / Kamali-Sarvestani E, Zolghadri J, Gharesi-Fard B. et al. // J Reprod Immunol. - 2005. - V. 65. - P. 171-178.
8. Kaur A. Recurrent pregnancy loss: TNF-α and IL-10 polymorphisms / Kaur A. // J Hum Reprod Sci. - 2011. - V. 4. - P. 91-94.
9. Kelemen K. Early recognition of pregnancy by the maternal immune system / Kelemen K., Paldi A., Tinneberg H. et al. // Am J Reprod Immunil. - 1998. - V. 39. - P. 351-355.
10. Krieg S. Global alteration in gene expression profiles of deciduas from women with idiopathic recurrent pregnancy loss / Krieg S., Fan X., Hong Y., Sang Q-X., Giaccia A., Westphal L., Lathi R., Krieg A., Nayak N. // Mol Hum Reprod. - 2012. - V. 18. - N 9. - P. 442-450.
11. Piccinni MP. T cells in normal pregnancy and recurrent pregnancy loss / Piccinni MP. // Reprod Biomed Online. - 2007. - V. 14. - Spec No 1. - P. 95-99.
12. Prigoshin N. Cytokine gene polymorphisms in recurrent pregnancy loss of unknown cause / Prigoshin N., Tambutti M., Larriba J. et al. // Am J Reprod Immunol. - 2004. - V. 52. - P. 36-41.

Введение

Цитокины как молекулы межклеточной сигнализации играют важнейшую роль на ранних этапах эмбрионального развития человека, обеспечивая образование и рост плаценты, ангиогенез, иммунотолерантность материнского организма. Основные продуценты цитокинов - имуннокомпетентные клетки - локализованы во всех органах генитального тракта женщины - яичниках, эндометрии матке, влагалище. Кроме того, цитокины во время беременности секретируются самим эмбрионом. При инвазии трофобласта происходит активация клеток иммунной системы, что приводит к синтезу целого спектра цитокинов. В случае преобладания Th1 цитокинов возможно нарушение деления и дифференцировки клеток плаценты и эмбриона, отторжение трансплантанта [6; 11]. Th2 цитокины синтезируют IL-4, IL-5, IL-10 и другие интерлейкины, обеспечивающие преимущественно гуморальные реакции, гемопоэз, ангиогенез, ангиогенез в децидуальной ткани и трофобласте. Предполагается, что после оплодотворения в зиготе синтезируются сигнальные молекулы, опосредующие активный внутриутробный синтез Th2 клеток [9].

Процессы формирования сосудистой сети и становления маточно-плацентарного кровотока являются ключевыми событиями, необходимыми для обеспечения основной функции плаценты - обмена кислородом и питательными веществами между организмами матери и плода. Факторы ангиогенеза (в том числе соcудисто-эндотелиальные, эпидермальные, инсулиноподобные, а также ряд интерлейкинов) начинают продуцировать на ранних этапах роста плода еще до начала процессов образования новых сосудов, формирования плаценты и ремоделирования материнских артерий. Помимо регуляции ангиогенеза, большинство этих факторов контролирует процессы дифференцировки пролиферации клеток, что проявляется в их влиянии на процессы инвазии трофобласта.

Риск потери плода может быть обусловлен изменением функциональной активности цитокинов, опосредующих иммунный ответ материнского организма на развивающийся плод [2; 8]. Дисрегуляция в функционировании цитокинов, в том числе обусловленная генотипом, может быть негативным фактором для протекания ранних этапов эмбриогенеза человека [5]. Целью данной работы было исследовать ассоциацию между полиморфизмом и уровнем экспрессии гена IL-10 и невынашиванием беременности в I триместре.

Материал и методы исследования

Для молекулярно-генетического исследования использовали образцы децидуальной и хорионической тканей, полученные при медицинском аборте у женщин с физиологическим течением беременности на сроке 6 - 11 недель (25 образцов), а также при спонтанном аборте и неразвивающейся беременности (33 образца) раннего срока. У женщин, включенных в исследуемые группы, были исключены анатомические и гормональные аномалии. Все женщины подписали информированное согласие об участии в исследовании.

Для выделения ДНК из тканей использовали фенол-хлороформный метод. Выделение тотальной РНК из образцов тканей материнского и зародышевого происхождения проводили экстракцией смесью гуанидинтиоционат-фенол-хлороформ.

Полиморфизм -819C-T гена IL-10 (MIM *124092) исследовали с использованием набора реагентов SNP-экспресс («Литех», Москва). Анализ основан на проведении реакций амплификации с двумя парами аллель-специфичных праймеров. Разделение продуктов амплификации проводили методом горизонтального электрофореза в 3%-ном агарозном геле. Анализ электрофореграмм проводили на трансиллюминаторе GelDoc (BioRad).

Для проведения реакции обратной транскрипции использовали набор реагентов компании «Синтол» (Москва). Реакцию обратной транскрипции проводили при температуре 45 °С в течение 50 минут. Затем следовала инактивация MMLV-RT при 92 °С в течение 8 минут. Уровень экспрессии гена IL-10 определяли с помощью real-time PCR с использованием флуоресцентных ген-специфичных зондов. Последовательность праймеров и зондов приведена в таблице 1. Реакцию амплификации проводили в двух повторах для каждого образца по следующей программе: 94 °С - 10 минут, 60 °С - 50 секунд, 94 °С - 15 секунд. Последние два шага повторяли 40 раз.

Таблица 1 – Характеристика праймеров и зондов, используемых для определения уровня экспрессии генов цитокинов

Ген

5`-3` последовательность праймеров и зонда

 

GAPDH

AGGTCGGAGTCAACGGATTT

ATCGCCCCACTTGATTTTGG

Fam-GGCGCCTGGTCACCAGGGCT-BHQ1

 

IL-10

ACGGCGCTGTCATCGATT

GGCATTCTTCACCTGCTCCA

Fam-CTTCCCTGTGAAAACAAGAGCAAGGCC-BHQ1

Статистический анализ полученных данных проводили с помощью программного пакета MS Excel. Соответствие распределения частот генотипов равновесию Харди-Вайнберга определяли по стандартным формулам. Оценку различий в распределении полиморфных вариантов генов в обследованных группах осуществляли по критерию χ2 при помощи программы BIOSTAT.

Статистический анализ результатов изучения уровня экспрессии генов проводили методом 2-∆∆Ct. Для сравнения уровня экспрессии генов использовали все значения экспрессии гена (∆Ct) и сравнивали их между собой как две выборки. Для подтверждения достоверности отличий экспрессии гена в совокупности одной из выборок образцов по сравнению с другой выборкой использовали критерий Стьюдента.

Результаты исследования и их обсуждение

IL-10 является ключевым регулятором иммунного ответа, который ингибирует секрецию провоспалительных цитокинов Th1-типа лимфоцитами и активированными макрофагами. В децидуальной и хорионической ткани при физиологической беременности количество гетерозиготных носителей полиморфного варианта гена IL-10 и гомозигот по аллели -819С одинаково (табл. 2). При невынашивании беременности доля гомозигот -819СС в децидуальной ткани составила 60%. Однако статистически значимых различий в частотах генотипов и аллелей между двумя сравниваемыми группами не выявлено. То же самое справедливо и для хорионической ткани (табл. 2).

Данные литературы о возможной связи между наличием исследуемого полиморфизма гена IL-10 и риском нарушения ранних этапов эмбриогенеза человека противоречивы. Одни авторы [2; 7; 8; 12] считают, что наличие полиморфизмов -592А, -819Т, -1082А промоторного участка гена IL-10 не ассоциировано с повышенным риском невынашивания беременности. А в исследованиях Costeas и его коллег [4] выявлена связь между данными тремя полиморфизмами и повышением риска спонтанного прерывания беременности. В ряде исследований показана важность анализа не отдельных полиморфизмов, а гаплотипов. В частности, «GCC» гаплотип (G в позиции -1082, C в позиции -819 и С в положении -592), индуцирующий высокий уровень транскрипции IL-10, связан с риском преждевременного разрыва околоплодной оболочки и преждевременными родами [1].

Таблица 2 - Частота генотипов (%) и аллелей по полиморфизму -819 C-Т гена IL-10 в хорионической и децидуальной тканях при невынашивании беременности

Генотип

Контроль, абс (%)

НБ, абс. (%)

OR (95% CI)

χ2 (P)

Хорионическая ткань

CC

10 (43,5%)

17 (51,5%)

1,38 (0,47 – 4,03

 

3,05 (0,22)

CT

11 (47,8%)

16 (48,5%)

1,03 (0,35 – 2,98)

TT

2 (8,7%)

0

0,13 (0,05 – 2,81)

Частота аллели -819Т

0,326

0,242

0,66 (0,29 – 1,52)

0,95 (0,33)

Децидуальная ткань

CC

12 (48,0%)

20 (60,6%)

1,67 (0,58 – 4,76)

 

3,12 (0,21)

CT

11 (44,0%)

13 (39,4%)

0,83 (0,29 – 2,37)

TT

2 (8,0%)

0

0,14 (0,01 – 3,06)

Частота аллели -819Т

0,3

0,197

0,57 (0,24 – 1,35)

1,65 (0,2)

Примечание: МА – медицинский аборт; НБ – невынашивание беременности

Анализ уровня экспрессии гена IL-10 показал, что при физиологически развивающейся беременности уровень мРНК гена IL-10 в децидуальной ткани не отличается от такового в хорионической ткани (рис. 1).

Рисунок 1 - Уровень экспрессии гена IL-10 в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при физиологически развивающейся беременности (А – децидуальная ткань; В – хорионическая ткань).

При неразвивающейся беременности уровень экспрессии гена IL-10 в децидуальной ткани статистически значимо выше по сравнению с показателем контроля (Р = 0,019) (рис. 2), а также по сравнению с хорионической тканью при неразвивающейся беременности (Р = 0,036) (рис. 3).

Рисунок 2 - Уровень экспрессии гена IL-10 в клетках децидуальной ткани относительно экспрессии гена GAPDH (А – физиологическое течение беременности; В – неразвивающаяся беременность).

Рисунок 3 - Уровень экспрессии гена IL-10 в клетках хорионической и децидуальной тканей относительно экспрессии гена GAPDH при неразвивающейся беременности (А – децидуальная ткань; В – хорионическая ткань).

Известно, что IL-10 принимает активное участие в обеспечении иммунотолерантности материнского организма к развивающемуся зародышу. Кроме того, IL-10 обеспечивает снижение уровня экспрессии децидуальными клетками ряда молекул – активаторов коагуляции [3]. Чрезмерная продукция цитокинов Th2 может сопровождаться неограниченной инвазией трофобласта. Таким образом, отклонение экспрессии гена IL-10 от оптимального уровня может обуславливать нарушение ранних этапов эмбриогенеза человека.

Анализ экспрессии 24500 генов в децидуальной ткани женщин с привычным невынашиванием беременности с использованием Illumina Ref-8 чипа выявил 155 генов, уровень экспрессии которых более чем в 2 раза отличается от контрольного [10]. При этом 23% среди них являются генами иммунного ответа. Доля других функциональных групп генов не превышает 18% [10]. Поскольку цитокины являются медиаторами межклеточных взаимодействий, изменение характера функционирования генов цитокиновой сети влечет за собой изменение в регуляции экспрессии и функционировании целого ряда метаболических каскадов. При изменении концентраций про- и противовоспалительных цитокинов возможно значительное повышение количества апоптических клеток и нарушение функционирования трофобласта в целом.

Рецензенты:

Амелина Светлана Сергеевна, доктор медицинских наук, заведующая отделом биомедицины НИИ биологии Южного федерального университета, г. Ростов-на-Дону.

Усатов Александр Вячеславович, доктор биологических наук, профессор, заведующий отделом изменчивости генома НИИ биологии Южного федерального университета, г. Ростов-на-Дону.


Библиографическая ссылка

Машкина Е.В., Коваленко К.А., Миктадова А.В., Волосовцова Г.И., Сараев К.Н. АНАЛИЗ ЭКСПРЕССИИ ГЕНА IL-10 В ДЕЦИДУАЛЬНОЙ И ХОРИОНИЧЕСКОЙ ТКАНЯХ ПРИ НЕВЫНАШИВАНИИ БЕРЕМЕННОСТИ // Современные проблемы науки и образования. – 2013. – № 5.;
URL: http://science-education.ru/ru/article/view?id=10208 (дата обращения: 10.12.2019).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074