Сетевое издание
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

ИССЛЕДОВАНИЕ ДНК-МАРКЕРОВ УСТОЙЧИВОСТИ ПОДСОЛНЕЧНИКА К ЗАРАЗИХЕ (OROBANCHE CUMANA WALLR.)

Маркин Н.В. 1 Усатов А.В. 1 Макаренко М.С. 1 Усатенко Т.В. 2 Горбаченко О.Ф. 2
1 Южный федеральный университет
2 Донская опытная станция им. Л.А. Жданова Всероссийского научно-исследовательского института масличных культур
С помощью молекулярно-генетического анализа образцов подсолнечника Донской опытной станции им. Л.А. Жданова ВНИИМК, с контрастной устойчивостью/чувствительностью к заразихе, был проведен поиск информативных RAPD-, SSR- и SCAR-маркеров. Среди исследованных 18 RAPD-маркеров специфичных для устойчивых образцов не обнаружено, однако два маркера - OPA17_1800 и UBC685_1500 были амплифицированы у 81% чувствительных образцов. 11 SSR-маркеров, взятые в анализ, также не позволили идентифицировать устойчивые генотипы. Среди изученных 9 SCAR-маркеров отсутствие амплификации двух - RTS 40 и RTS 40_1, позволили выделить группу неустойчивых образцов. Прямое секвенирование этих двух ампликонов - RTS 40 и RTS 40_1, полученных у неустойчивых растений, и их выравнивание с помощью программы Blast в GenBank NCBI выявило гомологию с последовательностью семейства генов NBS-LRR (№ HQ222362.1, GenBank NCBI), контролирующих устойчивость подсолнечника к комплексу патогенов. Сделано предположение, что участок NBS-LRR полиморфен у образцов, различающихся по устойчивости к заразихе, и что праймеры маркеров RTS 40 и RTS 40_1 комплементарны участкам, характерным неустойчивым образцам. Разработаны и апробированы 11 новых маркеров генов NBS-LRR и межгенных регионов локуса № HQ222362.1. Среди них два маркера - Zar1 и Zar2 - амплифицировались только у устойчивых к заразихе генотипов, тем самым подтвердив свою ценность в селекции подсолнечника.
генотипирование
ДНК-маркеры
секвенирование
заразиха подсолнечная
устойчивость
маркер-вспомогательная селекция
подсолнечник
1. Антонова Т.С. Вирулентность заразихи, поражающей подсолнечник в Волгоградской и Ростовской областях / Т.С. Антонова, Н.М. Арасланова, С.А. Рамазанова, С.З. Гучетль, Т.А. Челюстникова // Масличные культуры. Научно-технический бюллетень ВНИИ масличных культур. – Краснодар, 2011. – Вып. № 1 (146-147). – С. 127-130.
2. Усатов А.В., Азарин К.В., Тихобаева В.Е., Воличенко М.И., Гаврилова В.А., Маркин Н.В. ДНК-Маркеры устойчивости к ложной мучнистой росе (Plasmopara halstedii) у дикорастущих форм подсолнечника // Современные проблемы науки и образования. – 2013. – № 4. - URL: http://www.science-education.ru/110-9757.
3. Antonova T.S. The history of Interconnected evolution of Orobanche cumana Wallr. And Sunflower in the Russian Federation and Kazakhstan // Helia. -2014. – Vol. 37. – P. 215–225.
4. Antonova T.S. Distribution of highly virulent races of sunflower broomrape (Orobanche cumana Wallr.) in the Southern Regions of the Russian Federation / T.S. Antonova, N.M. Araslanova, E.A. Strelnikov, S.A. Ramazanova, S.Z.Guchetl, T.A. Chelyustnikova // Russian Agricultural Sciences, 2013. – Vol. 39. – № 1. – P. 46–50.
5. Bachlava E. Downy mildew (Pl8 and Pl14) and rust (RAdv) resistance genes reside in close proximity to tandemly duplicated clusters of non-TIR-like NBS-LRR-encoding genes on sunflower chromosomes 1 and 13. / E. Bachlava, O.E. Radwan, G. Abratti, S. Tang, W. Gao, A.F. Heesacker, M.E. Bazzalo, E. Zambelli, A.J. Leon, S.J. Knapp // Theor. Appl. Genet., 2011. – 122. – P. 1211–1221.
6. Hall T.A. BioEdit: a user – friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. // Nucleic Acids Symp. Ser. - 1999. – V. 41. – P. 95-98.
7. Katzir N. Use of random amplified polymorphic DNA (RAPD) markers in the study of the parasitic weed Orobanche / N. Katzir, V. Portnoy, G. Tzuri, M. Castejon-Munoz, D.M. Joel // Theoretical and Applied Genetics. - 1996. – V. 93. – P. 367-372.
8. Lu Y.H. Development of SCAR markers linked to the gene Or5 conferring resistance to broomrape (Orobanche cumana Wallr.) in sunflower / Y.H. Lu, J.M. Melero-Vara, J.A. García-Tejada, P. Blanchard // Theoretical and Applied Genetics. - 2000. – Vol. 100. – P. 625-632.
9. Markin N.V. SSR Analysis of Maternal and Paternal Lines Selected in the Don Region (Russia) / N.V. Markin, A.V. Usatov, V.N. Vasilenko, A.I. Klimenko, O.F. Gorbachenko, D.N. Maidanyuk, L.V. Getmantseva // Am. J. Agric. Biol. Sci. - 2016. – V. 11. – № 1. – P. 13-18. DOI :10.3844/ajabssp.2016.13.18.
10. Prez-Vich B. Quantitative trait loci for broomrape (Orobanche cumana Wallr.) resistance in sunflower / B. Prez-Vich, B. Akhtouch, S.J. Knapp, A.J. Leon, L. Velasco, J.M. Fernández-Martínez, S.T. Berry // Theoretical Applied Genetics. - 2004. – Vol. 109. – P. 92–102.
11. Seiler G.J. Wild Sunflower Species as a Genetic Resource for Resistance to Sunflower Broomrape (Orobanche cumana Wallr.) / G.J. Seiler, C.C. Jan // Helia. - 2014. – Vol. 37. – P. 129–139.
12. Tang S. Genetic Mapping of the Or5 Gene for Resistance to Orobanche Race E in Sunflower / S. Tang, A. Heesacker, V.K. Kishore, A. Fernandez, E.S. Sadik, G. Cole, S.J. Knapp // Crop Sci., 2003. – V.43. – P. 1021–1028.
13. Werle E. Convenient single-step, one tube purification of PCR products for direct sequencing / E. Werle, C. Schneider, M. Renner, M. Völker , W. Fiehn // Nucl. Acids Res., 1994. – V. 22. – № 20. – Р. 4354-4355.

Заразиха подсолнечная (Orobanche сumana Wallr.) представлена многочисленными расами, постоянно возникающими в результате сопряженной эволюции паразита и хозяина, которые способны преодолевать иммунитет устойчивых генотипов. В последнее время на юге России сотрудниками ВНИИ масличных культур дифференцировано 8 рас O. cumana: A, B, C, D, E, F, G, H [1; 3; 4]. Угроза снижения урожаев подсолнечника вследствие быстрого распространения новых рас заразихи на юге РФ актуализировала направление селекции подсолнечника на создание устойчивых генотипов к этому растению-паразиту.

Внедрение молекулярных маркеров в современные селекционные программы позволяет многократно повысить эффективность отбора перспективных образцов, в том числе устойчивых к патогенам [10; 11].

Целью работы является поиск информативных ДНК-маркеров устойчивости подсолнечника к заразихе.

Материалы и методы

На инфекционном фоне в оранжерее Донской опытной станции им. Л.А. Жданова ВНИИ масличных культур были выделены образцы, контрастно различающиеся по устойчивости/чувствительности к наиболее вирулентным в Ростовской области расам заразихи O. cumana (табл. 1). Для создания инфекционного фона использовали смесь семян заразихи, собранных в различных районах и агроклиматических зонах Ростовской области. Поражаемость оценивали по наличию проростков заразихи на корнях исследуемых образцов. В работе использовали 18 RAPD-маркеров: P36, P37, P38, P46, P53, OPT-08, OPW-04, OPW-06, OPW-09, OPW-10, OPW-15, OPX-01, UBC-73, UBC-120, UBC-264, UBC-318, UBC-685, OPA-17 [7]; 11 SSR-маркеров: ORS 1222, ORS 1114, ORS 1036, ORS 1056, ORS 1040, ORS 202, ORS 1112, ORS665, ORS 1021, ORS 718, ORS 545 [12] и 9 SCAR-маркеров: RTS05, RTS 05_1, RTS 28, RTS 29, RTS 29_1, RTS40, RTS40_1, RTS 41, RTS 43 [8], ассоциированных, по данным литературы, с устойчивостью подсолнечника к O. cumana.

Таблица 1

Образцы подсолнечника, исследованные на наличие ДНК-маркеров устойчивости к заразихе

№ пробы

Генотипы, устойчивые

к заразихе

№ пробы

Генотипы, не устойчивые

к заразихе

1

J-2/2979

22

С-1/98

2

C-1/87

23

С-1/132

3

C-1/144

24

J-2/4341

4

J-3/2822

25

Донской 22

5

J-3/2825

26

J-2/4412

6

J-4/495

27

J-5/169

7

J-4/501

28

J-5/931

8

J-4/507

29

J-5/236

9

J-4/509

30

J-5/1448

10

J-4/517

31

J-4/169

11

J-4/525

32

J-4/931

12

J-3/2849

33

J-4/236

13

J-4/541

34

J-5/73

14

J-4/546

35

J-5/383

15

J-3/3136

36

J-5/869

16

J-4/746

37

J-5/169

17

J-4/756

38

J-5/931

18

J-4/759

39

J-3/236

19

J-2/4402

40

J-3/73

20

J-2/4405

41

J-3/45

21

J-2/4417

 

 

 

Геномную ДНК выделяли из высечки листовой ткани сорбентным методом [9]. Полимеразную цепную реакцию проводили согласно [2]. Реакцию амплификации проводили в термоциклере Palm-Cycler (Corbett Research, Австралия) по следующей программе для RAPD анализа: 1) один цикл: 4 мин. 94 °С; 30 циклов: 1 мин. 94 °С, 1 мин. 37 °С, 1 мин. 72°С; один цикл: 10 мин. 72 °С; для SSR- и SCAR-анализа 1) один цикл: 4 мин. 94 °С; 35 циклов: 1 мин. 94 °С, 1 мин. 60 °С, 1 мин. 72°С; один цикл: 10 мин. 72 °С. Очистку фрагментов амплифицированной ДНК для прямого секвенирования выполняли согласно [13]. Нуклеотидные последовательности определяли с использованием набора реагентов ABI Prism BigDye Terminator v.3.1.(«Applied Biosystems», USA) согласно прилагаемой инструкции с последующим анализом продуктов на секвенаторе ABI Prism 3130xl. Хромотограммы анализировали с помощью пакета программ BioEdit 7.0.9.0. [6].

Для дизайна праймеров использовали программу Primer Quest Tool от Integrated DNA Technologies, Inc.

Результаты

Среди исследованных 18-ти RAPD маркеров, специфичных для устойчивых образцов не обнаружено, однако два маркера - OPA17_1800 и UBC685_1500, были амплифицированы у 81% чувствительных образцов. Интересно отметить, что RAPD маркер UBC120_660, описанный в работе [8], как ассоциированный с устойчивостью к заразихе, оказался не информативным в нашей выборке генотипов. Остальные маркеры также оказались неинформативными для кластеризации генотипов по признаку устойчивости/чувствительности к патогену.

Результаты амплификация ДНК изучаемых образцов с 11 SSR-праймерами показали, что электрофоретические профили существенно отличаются друг от друга, однако они также не коррелировали с устойчивостью подсолнечника к заразихе.

Из 9 SCAR-маркеров, только два - RTS 40 и RTS 40_1, позволили кластеризовать исследуемые генотипы. На электрофореграммах у всех устойчивых образцов отсутствовали бэнды размером около 360 п.н. (маркер RTS 40) и 300 п.н. (маркер RST 40_1), которые были характерны для неустойчивого к заразихе подсолнечника.

В дальнейшем мы провели секвенирование этих двух ампликонов, последовательности нуклеотидов которых приведены в таблице 2.

Таблица 2

Последовательности нуклеотидов ДНК фрагментов

ДНК-маркеры

Последовательность нуклеотидов

RTS 40

ACAATGGCCGCCGAAGCCCACTGCGGTAACCCGGTTCGGCTCGGTTTCGAACTGACGATCTCCAAAGAGGCCTAGTTCTAAACTTCATTGCCACCACCAATGTCCTTCAAAGTGATGCTAGTGGGAGTAAACCCCTAATGTGAGCTCGACAATAGCTTGAAAATTGTAATCATAACTAAGCTTGATGAAATAACTCGGATTTAAAAGCTTTAATGGCTTGATATGTCTAGTAGAGTTTCGTTGATAAAATGGCCCAAAATATATGTTCAAATCGCTCGTCGCTTATCGCTCGCTCGCCGATCGTTCGGAAAACGCTCGGAATATGTCCGCTCGGTGGAA

RTS 40_1

GGCATTTTTATCACGAAACTCTACTAGACATATCAAGCCATTAAAGCTTTTAATCCGAGTTATTTCATCAAGCTTAGTTATGATTACAATTTTCAAGCTATTGTCGAGCTCACATTAGGGGTTTACTCCCACTAGCATCACTTTGAAGGACATTGGTGGTGGCAATGAAGTTTAGAACTAGGCCTCTTTGGAGATCGTCAGTTCGAAACCGAGCCGAACCGGGTTTTACCGCAGTGGGCCTTCGGGCGGCGGGTTTTCTCCGGAACTGGTAGCTCA

 

Данные последовательности были проанализированы с помощью программы Blast в GenBank NCBI. Оказалось, что нуклеотидные последовательности фрагмента ДНК, амплифицированного с праймером RTS 40 на 98%, а с праймером RTS 40_1 на 81% гомологичны последовательности № HQ222362.1 в GenBank [5], в которой расположены гены NBS-LRR, контролирующие устойчивость подсолнечника к комплексу патогенов.

Исходя из полученных результатов, был расширен поиск маркеров, ассоциированных с устойчивостью к заразихе, и определены 11 новых маркеров генов NBS-LRR и межгенных регионов локуса № HQ222362.1. Для идентификации этих маркеров нами были разработаны новые праймеры (табл. 3).

Таблица 3

Праймеры для идентификации генов NBS-LRR и межгенных регионов

Локус

Последовательность оснований (5'-3')

Размер, п.н.

Тm, 0С

GenBank

1

Zar1

GCATCACTTTGAAGGACATTGG

ATGCGTTGTGTAATTCTTGTATGG

529

60

HQ222362.1

2

Zar2

CCAACTCTGACCGTTATGAAGA

GCGATGTCTAGTTGTTTGGTTG

437

60

HQ222362.1

3

Zar3

TATGGAGGATCTGGTCGGTTAG

GAAAGTGGTTGTGAGTGAAGGA

716

60

HQ222362.1

4

Zar4

CAACCATGCACTCCCAATTTAC

GTTGCCCAACAACTTCCTAATG

990

60

HQ222362.1

5

Zar5

TAAACAAGAAGCAAGGCATCAAG

GTGCTCTATCGAACGGGAATAA

317

60

HQ222362.1

6

Zar6

TGGGTAATCTCCTACTACCCTAAA

GAATGCCAAGTTCTTCTCGAATG

301

60

HQ222362.1

7

Zar7

CGAACAACTGGTGTGCATTT

GTGTTGCCACTGCAAGTTATG

356

60

HQ222362.1

8

Zar8

CCCAACGTCTCAACGTTATCT

GGGAGAAATGGGCAAACAATAC

568

60

HQ222362.1

EU924141.1

9

Zar9

ACATGCCTTTCTGTGAATGGA

GAGTTCAGGATCTGGGATTTGG

206

60

HQ222362.1

10

Zar10

CCAACCCAAATGACCAAGAATAG

CTGATGCCCGAGAGTCTTTAC

234

60

HQ222362.1

11

Zar11

GCAGTGAGGACGGTTGTTAG

AAGCAGAACAATGATGGACAAATC

200

60

HQ222362.1

Из 11 маркеров только два – Zar1 и Zar2, оказались информативными для идентификации генотипов, устойчивых к заразихе. Так, у 90% устойчивых форм наблюдается амплификация фрагментов 529 и 437 п.н., отсутствующих у поражаемых образцов.

Выводы

С помощью 18 RAPD-, 11 SSR- и 9 SCAR-маркеров, которые, по данным литературы, ассоциированы с устойчивостью подсолнечника к заразихе, были генотипированы образцы Донской опытной станции ВНИИМК, контрастно различающиеся по устойчивости/чувствительности к наиболее вирулентным в Ростовской области расам. Ни один из этих маркеров не был специфичным для устойчивой группы генотипов. Однако два RAPD-маркера - OPA17_1800; UBC685_1500 и два SCAR-маркера - RTS 40; RTS 40_1 были характерны для неустойчивых к заразихе образцов.

Прямое секвенирование и поиск гомологии в GenBank NCBI маркеров - RTS 40 и RTS 40_1, позволил найти последовательность семейства генов NBS-LRR, контролирующих устойчивость подсолнечника к комплексу патогенов. Используя последовательность локуса NBS-LRR (№ HQ222362.1, GenBank NCBI), были определены 11 новых маркеров генов и межгенных регионов. Среди них два маркера - Zar1 и Zar2 - оказались информативными для идентификации генотипов, резистентных к заразихе. Эти маркеры могут представлять непосредственный интерес в селекции подсолнечника.


Библиографическая ссылка

Маркин Н.В., Усатов А.В., Макаренко М.С., Усатенко Т.В., Горбаченко О.Ф. ИССЛЕДОВАНИЕ ДНК-МАРКЕРОВ УСТОЙЧИВОСТИ ПОДСОЛНЕЧНИКА К ЗАРАЗИХЕ (OROBANCHE CUMANA WALLR.) // Современные проблемы науки и образования. – 2016. – № 6. ;
URL: https://science-education.ru/ru/article/view?id=25483 (дата обращения: 18.09.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074