Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

THE PREVALENCE OF AMINOGLYCOSIDE-MODIFYING ENZYME GENES AMONG STRAINS OF STAPHYLOCOCCUS AUREUS, ISOLATED FROM ORTHOPEDIC PATIENTS

Polyakova E.M. 1 Gurbanova A.B. 1 Labutin D.V. 1 Bozhkova S.A. 1 Gordina E.M. 1
1 Vreden Russian Research Institute of Traumatology and Orthopedics
Implant-associated infection is one of the most serious complications of orthopedic surgery. For patients with implant-associated infection surgical intervention is performed in two stages, the first of which includes sanitation of a purulent focus, removal of an infected implant and replacement of bone defects formed during the operation with an individual bone cement structure – a spacer containing an antibacterial component. Some of the most commonly used in the composition of bone cement are drugs from the class of aminoglycosides - gentamicin and tobramycin. The effectiveness of this tactic of patient management directly depends on the susceptibility of the infectious agent to the antibiotic in the spacer. The aim of the study was to identify genes and their associations encoding aminoglycoside-modifying enzymes in S. aureus strains with phenotypic resistance to aminoglycosides isolated from patients with orthopedic infection. A total of 268 cultures of S. aureus isolated from patients with implant-associated infection were studied. The antibiotic susceptibility of the isolates was studied by the disk diffusion method in accordance with the EUCAST requirements. The presence of AME genes in cultures with phenotypic resistance to aminoglycosides was determined by PCR. The analysis of the data obtained was carried out using the Fisher test. Antibiotic susceptibility was tested to gentamicin, amikacin, and tobramycin. There was a strong association of aac(6’)-Ie/aph(2”) and aac genes with phenotypic resistance to all three antibiotics. These results demonstrate aac(6’)-Ie/aph(2”) and aac as determinants of S. aureus aminoglycoside resistance in orthopedic implant-associated infection.
aminoglycoside-modifying enzyme
S. aureus
implant-associated infection
prosthetic joint infection

Эндопротезирование – распространенный высокоэффективный метод лечения дегенеративных заболеваний крупных суставов верхних и нижних конечностей, который широко используется в стационарах РФ. Несмотря на применение современных антисептических и антибактериальных средств, усовершенствованных металлоконструкций и техники оперативного вмешательства, частота развития имплант-ассоциированной и перипротезной инфекций остается неизменной [1]. Перипротезная инфекция (ППИ) как осложнение эндопротезирования является второй по частоте причиной ревизии эндопротезов тазобедренного сустава, а ее частота составляет около 1% после первичных вмешательств и до 4% после ревизионных операций.

Представители рода Staphylococcus являются одними из основных возбудителей ортопедической инфекции с широким набором факторов патогенности. Наиболее проблемными и затратными для лечения являются инфекции, вызванные метициллин-резистентными S. aureus (MRSA). Несмотря на высокую природную чувствительность стафилококков к подавляющему большинству антибиотиков, антибактериальная терапия ППИ может представлять серьезную проблему из-за формирования биопленок на поверхности имплантатов и механизмов антибиотикорезистентности [1], именно поэтому в современных условиях необходима разработка новых альтернативных методов борьбы с инфекционными агентами. Кроме того, S. aureus характеризуются разнообразными механизмами персистенции, включая секретируемые токсины, способностью уклоняться от иммунной системы макроорганизма и развитием устойчивости к противомикробным препаратам. В результате этих высокоразвитых патогенных механизмов персистенции клинические рецидивы ортопедической инфекции, вызванной S. aureus, остаются значимой проблемой.

В профилактике развития любой имплант-ассоциированной инфекции ключевым моментом является предупреждение микробной адгезии и формирования микробного очага. При первичном эндопротезировании «первая линия обороны» – это антибактериальные препараты в качестве периоперационной антибиотикопрофилактики. Кроме того, некоторые исследователи рекомендуют применение антибиотиков в составе костного цемента, которым фиксируют компоненты эндопротеза, что, по их мнению, обеспечивает первоначальный защитный барьер против инфицирования эндопротезов.

С 1970 г. в качестве локальной антибактериальной терапии при различной ортопедической патологии используют костный цемент на основе полиметилметакрилата с добавлением гентамицина. Применение спейсеров, состоящих из костного цемента с гентамицином, в течение периода проведения локальной антибиотикотерапии в области тазобедренного сустава в большинстве случаев позволяет предупредить развитие инфекционного процесса [2, 3]. Причиной развития данного осложнения в большинстве случаев является интраоперационное инфицирование.

Для местной профилактики и лечения инфекционных осложнении? используют добавление антибиотиков группы аминогликозидов, в частности гентамицина и тобрамицина, в костный цемент, который применяют для фиксации компонентов эндопротезов у пациентов с остеопорозом, или в качестве антимикробных спейсеров для замещения дефектов костной ткани при лечении перипротезной инфекции и остеомиелита [2–4]. При этом, как правило, гентамицин является компонентом официнального костного цемента, а тобрамицин добавляют ex temporo при интраоперационном изготовлении спейсеров. Однако, несмотря на доказанную эффективность метода, возникновение ППИ остается серьезной проблемой в лечении ортопедических пациентов [5]. Для корректной локальной терапии ППИ необходимы своевременная диагностика и четкая стратегия лечения с учетом возможной резистентности возбудителя к антибактериальным препаратам.

Аминогликозиды обладают широким спектром действия, эффективны против грамположительных и грамотрицательных бактерий. Основным механизмом устойчивости у бактерий к аминогликозидам является продукция аминогликозидомодифицирующих ферментов (АМФ) [6]. Модифицированные молекулы антибиотика теряют способность связываться с рибосомами и подавлять биосинтез белка. Определенное клиническое значение имеет распространение среди грамположительных бактерий бифункционального фермента ААС(6')-APH (2''), разрушающего большинство клинически значимых аминогликозидов (кроме стрептомицина и спектиномицина) [7]. Гены АГМФ локализуются на мобильных генетических элементах, что обусловливает их быстрое распространение. Устойчивость к гентамицину является маркером наличия этого фермента у конкретного штамма, так как другие ферменты, распространенные среди грамположительных бактерий, не инактивируют этот антибиотик [7].

В литературе все чаще встречаются сообщения о повышении устойчивости грамположительных кокков к аминогликозидам и неэффективности цемента, импрегнированного аминогликозидами, при двухэтапной ревизии [8]. В свою очередь, гены устойчивости к антибиотикам, такие как mecA, vanA, blaOXA и другие, давно используются в качестве маркеров фенотипической устойчивости в анализах на основе ПЦР [9]. Аналогичные тест-системы с возможностью определения детерминант резистентности к аминогликозидам помогут клиницистам в момент выбора антибактериального препарата в составе спейсера для эффективной местной терапии ППИ.

Цель исследования – оценить наличие и распространенность генов и их ассоциаций, кодирующих аминогликозидомодифицирующие ферменты, у штаммов S. aureus с фенотипической устойчивостью к аминогликозидам, выделенных от пациентов с ортопедической инфекцией.

Материалы и методы исследования

Микробиологические методы. Выполнено исследование 268 культур S. aureus, выделенных от пациентов с имплантат-ассоциированной инфекцией, из них 59,7% (n=160) – с перипротезной инфекцией. Изоляты были извлечены из биопленок, сформированных патогенами на поверхности имплантатов, и интраоперационных тканевых биоптатов. Наличие плазмокоагулазы у тестируемых штаммов изучали с использованием сухой кроличьей плазмы («Микроген», Россия). Видовую идентификацию осуществляли на панелях Microlatest («Erba Lachema») с помощью iEMS Reader MF («Labsistems», Финляндия). Антибиотикочувствительность изолятов изучали диско-диффузионным методом, в соответствии с требованиями EUCAST [10]. Для этого взвесь суточных культур S. aureus в стационарной фазе роста наносили ватным тампоном на поверхность агара Мюллера–Хинтона (МХА) и через 5 мин вносили диски с гентамицином (нагрузка 10 мкг), амикацином (30 мкг) и тобрамицином (10 мкг) производства «Oxoid» (Великобритания). Чашки инкубировали при 35оС 18–24 ч и оценивали зону задержки роста в миллиметрах [10].

Молекулярно-генетические методы. Бактериальную ДНК выделяли с использованием набора «S-Sorb» («Синтол», Россия) и измеряли с использованием набора Qubit DNA на флуорометре «Qubit 3.0» («Thermo Fisher Scientific», США) в соответствии с инструкциями производителя. ПЦР проводили на амплификаторе «CFX96 Touch» («Bio-Rad», США) с использованием реагентов производства компании «Синтол» (Россия). Реакционный объем составлял 25 мкл. Параметры циклирования: 95ºC в течение 3 мин и 33 цикла в 3 последовательных этапа: 95ºC в течение 10 с, 55ºC в течение 15 с и 72ºC в течение 15 с. Праймеры были разработаны с использованием программного обеспечения Primer-BLAST (табл. 1). Конечные продукты ПЦР визуализировали в 1,0%-ном агарозном геле, окрашенном этидиум бромидом.

Таблица 1

Последовательности праймеров, использованных в работе

Ген

Направление и

последовательность праймера (5'→3')

Размер продукта, п.н.

aac(6’)-Ie/aph(2”)

Прямой

TGCCACACTATCATAACCAC

102

Обратный

GCCACAAATGTTAAGGCAAT

aac

Прямой

CATGGCAAGCTCTAGGATT

323

Обратный

GGCTGAGTTTATGGAAGAAG

ant(4’)-Ia

Прямой

GTTTGGGCTTCTACCGATTT

121

Обратный

CTCAGGTGGAATCAGATTGG

ant1

Прямой

GGTGGTTTACGCATTAACAG

479

Обратный

TCACCAGTAGTCACTGTTTG

 

Статистический анализ. Данные анализировали при помощи критерия Фишера (F-тест) с использованием программного обеспечения GraphPad Prism 6.0. Статистически значимыми принимали значения p менее 0,05.

Результаты исследования и их обсуждение. В исследование были включены 268 культур, выделенных от пациентов с имплант-ассоциированной и перипротезной инфекциями, а также остеомиелитом. Из 268 изолятов S. aureus, выделенных от пациентов ортопедического профиля, 58,6% (n=157) были резистентны к цефокситину (MRSA), 41,4% (n=111) – чувствительны (MSSA).

Анализ чувствительности выделенных бактериальных культур к аминогликозидам показал, что 75,8% штаммов MRSA (n=119) демонстрировали устойчивость к гентамицину и тобрамицину, 24,2% (n=38) – чувствительность. 65,0% (n=104) и 6,3% (n=10) штаммов были устойчивыми и умеренно резистентными к амикацину соответственно. Чувствительностью к амикацину характеризовались 28,7% изолятов MRSA (n=45) (р<0,0001). Одновременная устойчивость ко всем трем антибиотикам была выявлена только у 28% штаммов MRSA (n=44). Среди штаммов MSSA только три были устойчивы к гентамицину и тобрамицину, два штамма – к амикацину.

Ранее Campoccia et al. продемонстрировали, что частота встречаемости гена aac(6’)-Ie/aph(2”) у изолятов S. epidermidis, выделенных от пациентов ортопедического профиля, составила 44% [11]. Авторы также сообщили о снижении (7%) распространенности ant (4’)-Ia среди культур, выделенных от пациентов с имплантат-ассоциированной инфекцией.

В своем исследовании B. Fatholahzadeh et al. показали, что чувствительность штаммов MRSA составила: канамицин 97%; тобрамицин 96%; энтамицин 87%; амикацин 93%. Наиболее распространенными генами аминогликозидомодифицирующих ферментов были aac(6')-Ie-aph (2'') (83%) и ph(3')-IIIa (71%). Сосуществование трех генов AMФ обнаружено в 21% случаев. Наименее часто у изолятов регистрировали ген ant(4')-Ia. Полученные результаты согласовались с результатами тестирования чувствительности данных культур MRSA к аминогликозидам диско-дифузионным методом [12].

В нашем исследовании ген aac(6’)-Ie/aph(2”) был выявлен у 45,5% штаммов S. aureus (n=122), гены aac и ant1 – у 27,2% (n=73) и 18,3% (n=49) соответственно. Ген ant(4’)-Ia обнаружен не был.

Процент изолятов, содержащих в своем геноме гены АМФ, был существенно выше среди штаммов MRSA по сравнению со штаммами MSSA: aac(6’)-Ie/aph(2”) –75,8% (n=119) против 2,7% (n=3) (p<0,0001), aac – 45,9% (n=72) против 0,9% (n=1) (p<0,0001), ant1 – 23,6% (n=37) против 10,8% (n=12) (p=0,01) соответственно (табл. 2). Высокая распространенность генов, кодирующих АМФ, может быть объяснена их ключевой ролью в резистентности к аминогликозидам [13].

Таблица 2.

Частота встречаемости генов аминогликозидомодифицирующих ферментов

среди S. aureus (%)

Ген АМФ

MRSA

(n=157)

MSSА

(n=111)

p

aac(6’)-Ie/aph(2”)

75,8

2,7

<0,0001

aac

45,9

0,9

<0,0001

ant1

23,6

10,8

=0,01

 

Анализ данных о присутствии генов АМФ у исследованных штаммов S. aureus в зависимости от их чувствительности к гентамицину, тобрамицину и амикацину позволил выявить сильную взаимосвязь между наличием гена aac(6’)-Ie/aph(2”) и их устойчивостью к гентамицину и тобрамицину.

Так, ген aac(6’)-Ie/aph(2”) присутствовал в геноме всех изученных S. aureus, устойчивых к гентамицину и тобрамицину, и не был детектирован ни у одной бактериальной культуры, чувствительной к данным антибиотикам. В то же время в отношении амикацина результаты для данного гена были менее однозначными: ген aac(6’)-Ie/aph(2”) был выявлен не только у 100% резистентных и умеренно резистентных к амикацину изолятов, но и у 5,2% (n=8) чувствительных. В соответствии с представленными данными, ген aac присутствовал только у изолятов S. aureus, устойчивых к гентамицину и тобрамицину (59,8%, n=73), и не был выявлен ни у одного из штаммов, чувствительных к тестируемым антибактериальным препаратам. В то же время ген aac присутствовал в геноме 3 бактериальных культур, умеренно резистентных к амикацину (рисунок).

 

Распространенность генов аминогликозидомодифицирующих ферментов среди штаммов S. aureus в зависимости от их чувствительности к аминогликозидам

Ген ant1 выявлен у 29,5% (n=36) штаммов, устойчивых к гентамицину и тобрамицину, и у 8,9% (n=13), чувствительных к данным антибиотикам.

В свою очередь, анализ комбинаций генов аминогликозидомодифицирующих ферментов в геноме изученных штаммов S. aureus показал, что у 50% изолятов, содержащих ген aac(6’)-Ie/aph(2”), также присутствовал ген aac (n=61).

Следует отметить, что комбинация генов aac(6’)-Ie/aph(2”) и ant1 была выявлена у 20% культур (n=24), и только 10% штаммов (n=12) одновременно содержали в своем геноме все три гена.

Приведенные результаты подтверждают существенную значимость генов aac(6’)-Ie/aph(2”) и aac в формировании резистентности S. aureus к гентамицину и тобрамицину в сравнении с геном ant1 (p<0,0001).

Заключение. Ген aac(6’)-Ie/aph(2”) выявлен у 45,5% штаммов. Процент изолятов, содержащих в своем геноме гены АМФ, был существенно выше среди штаммов MRSA по сравнению со штаммами MSSA. Показана особая важность двух генов, кодирующих аминогликозидомодифицирующие ферменты, – aac(6’)-Ie/aph(2”) и aac – как детерминант устойчивости S. aureus к гентамицину и тобрамицину при ортопедической инфекции. При этом роль гена aac(6’)-Ie/aph(2”) в возникновении резистентности представляется ключевой. Детекция данного гена у изолятов S. aureus может быть рекомендована в качестве клинического скринингового теста на этапе выбора антибактериального препарата для использования в составе костного цемента при изготовлении спейсера. В перспективе для быстрой идентификации генов резистентности к аминогликозидам у штаммов S. aureus требуется разработка мультиплексных ПЦР с дальнейшей стандартизацией метода и возможностью внедрения в лаборатории.