Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940


Mokhammed A.M. 1, 2 Potemkin I.A. 2 Karlsen A.A. 2 Isaeva O.V. 2 Kyuregyan K.K. 2 Kozlov V.G. 3 Zhavoronok S.V. 4 Mikhaylov M.I. 1, 2
1 Russian Peoples friendship university
2 Institute of Poliomyelitis and Viral Encephalitis named after MP Chumakov
3 2Federal State Unitary Enterprise on Manufacture of Bacterial and Viral Preparations of Chumakov Institute of Poliomyelitis & Viral Encephalitides
4 Belorussky State University
Data on the prevalence and genetic diversity of rabbit HEV in endemic and non-endemic regions are limited, as well as information about the significance of rabbit HEV for human pathology. The aim of this study was to evaluate the prevalence of HEV-infection in farmed rabbits from non-endemic (Russia and Belarus) and endemic (Egypt) regions, and to analyze the genetic relatedness of rabbit strains to human and swine HEV strains isolated in these regions.Serum anti-HEV was tested in ELISA is serum samples from 55 rabbits from Russia and 40 rabbits from Belarus. HEV RNA was tested using RT-PCR with degenerative primers to ORF2 in feces samples from 173 farmed rabbits from Egypt (4 farms from different regions), from 206 rabbits from Russia (5 farms from different regions) and 103 rabbits from Belarus (2 farms). All animals were 2-12 months of age. Anti-HEV prevalence in rabbits at age ≥ 6 months was 81.5%-82.2% in Russia and 12.5% in Belarus, respectively. HEV RNA was detected in none of 173 rabbits from 4 farms in Egypt. In Russia prevalence of HEV RNA in rabbits varied in different farms from 0% to 13.8%, in Belarus – from 11.0% to 30.0%. HEV prevalence peaked in different age groups at different farms, with majority of infections at age 2-4 months or 6-10 months. Phylogenetic analysis did not reveal any relatedness of rabbit HEV strains neither to HEV genotype 3 sequences from patients with autochthonous hepatitis E in Russia nor to swine HEV isolates from this region. Thus, HEV is prevalent in rabbits in Russia and Belarus with all rabbit strains belonging to species-specific group which is close to genotype 3. Rabbit HEV infection in Egypt was not documented. The role of rabbit HEV in human disease in non-endemic regions appears to be limited.
hepatitis E virus
Вирус гепатита Е (ВГЕ) является этиологическим агентом острого гепатита. В развитых странах, находящихся в умеренном климатическом поясе, последние годы наблюдается спорадическая заболеваемость гепатитом Е (ГЕ), связанная не только с посещением гиперэндемичных территорий, но и с автохтонными случаями инфекции, вызванной 3 и 4 генотипами ВГЕ [1]. В настоящее время установлено, что ГЕ, ассоциированный с 3 и 4 генотипами вируса, является зоонозной инфекцией, что подтверждается существованием случаев заражения людей при употреблении в пищу недостаточно обработанного термически мяса инфицированных животных, преимущественно  свиней. Исчерпывающим доказательством того, что именно мясо животных служит источником вируса, является идентичность нуклеотидных последовательностей ВГЕ, выделенных от заболевших и из мясных продуктов[4].

Открытия последних лет показали разнообразие циркулирующих вариантов вируса ГЕ. Были определены последовательности изолятов ВГЕ, выделенных от различных видов животных, таких как олени, мангусты, кролики и крысы [10]. На основании результатов анализа геномных последовательностей вирусов, выделенных от животных, сделано предположение о существовании новых видов. Помимо собственно ВГЕ, представленного четырьмя (или пятью) генотипами, описана еще целая группа сходных вирусов животных, которая, по-видимому, будет только увеличиваться по мере проведения исследований [10]. Однако с точки зрения патологии человека интерес представляют только четыре генотипа ВГЕ – генотипы 1 и 2, способные инфицировать только человека, и генотипы 3 и 4, способные инфицировать как человека, так и животных (преимущественно свиней и оленей).

В настоящее время отсутствует четкое понимание механизма реализации пищевого пути передачи ВГЕ от инфицированного животного к человеку. Наибольшее число случаев заражения связано с употреблением в пищу печени животных. Очевидно, наибольший интерес представляет изучение свойств вируса и механизмов его передачи среди животных, с которыми возможен непосредственный контакт  человека (например, разведение  в условиях ферм, употребление в пищу).

В 2009 году C. Zhao с соавторами описали выделенный в Китае от домашнего кролика вариант ВГЕ и предположили его принадлежность к новому генотипу вируса [7]. При изучении распространенности ВГЕ среди кроликов, содержащихся на фермах различных регионов мира (США, Китай, Франция), а также в популяциях диких кроликов, было показано, что эти животные могут являться резервуаром вируса и вызывать инфекцию у человека [7]. Анализ нуклеотидной последовательности полного генома вируса показал сходство с генотипами 1–4 ВГЕ на 72,2–78,2%, при этом наиболее близким он оказался к третьему генотипу ВГЕ [7]. Таким образом, возможность передачи ВГE кроликов человеку поднимает важную проблему общественного здравоохранения по безопасности пищевых продуктов и зоонозных рисков. Данные по распространенности и генетическомуразнообразиию ВГЕ кроликов в Российской Федерации и на сопредельных территориях отсутствуют, равно как и сведения о выявлении ВГЕ кроликов у людей, заболевших ГЕ.

Цель исследования:определить распространенность и генетическое разнообразие вируса гепатита Е кроликов на территориях с разной степенью эндемичности по гепатиту Е.

Материалы и методы

Основным материалом исследования являлись образцы сыворотки крови и фекалий кроликов. Анти-ВГЕ класса IgG определяли методом ИФА в образцах сыворотки крови, полученных от выращенных на фермах кроликов в возрасте до 6 месяцев. Всего было обследовано 95 образцов сыворотки крови: из Москвы - 27 образцов, Московской области - 28 и Белоруссии - 40.Анти-ВГЕ класса IgG определяли в образцах сыворотки крови кроликов с помощью коммерческого диагностикума ДС-ИФА-АНТИ-HЕV-G (производство НПО «Диагностические системы», Россия). Поскольку данный набор предназначен для выявления анти-ВГЕ IgG человека с видоспецифичнымконъюгатом, в постановке вместо конъюгата из набора использовали антикроличийконъюгат (антитела козьи, аффинно-очищенные, специфичные к  иммуноглобулинам IgG, IgA, IgM кролика, меченные пероксидазой хрена; производство «ИМТЕК», Россия) в разведении 1:10000 в фосфатно-солевом буфере.

РНК ВГЕ определяли в образцах фекалий кроликов возрасте от 2 до 12 месяцев. Всего было собрано и протестировано на наличие РНК ВГЕ 482 образца фекалий кроликов. Сбор  материала выполнялся в период с мая 2012г. по декабрь 2014 г. Все образцы собирались индивидуально от кроликов на фермах на территории РФ, Египта и Республики Беларусь. На территории РФ были обследованы 6 ферм, расположенных в 4 регионах – г.Москва, Московская область (г. Электрогорск), Белгородская область (районы Старый Оскол и Корочанский), Свердловская область; на территории Египта были обследованы 4 фермы (города Луксор, Файюм, Каир, Банха), в Беларуси были обследованы 2 фермы.

Для выделения нуклеиновых кислот из образцов фекалий готовили 10%-ный осветленный фекальный экстракт. Нуклеиновые кислоты выделяли из осветленных фекальных экстрактов с помощью набора для выделения нуклеиновых кислот (производство НПО «Литех») по протоколу производителя. Выявление РНК ВГЕ проводили во вложенной ОТ-ПЦР с вырожденнымипраймерами к участку открытой рамки считывания 2 (ОРС 2) ВГЕ. Первая пара праймеров - 5'–aaytatgcmcagtaccgggttg -3’ (прямой) и 5’–cccttatcctgctgagcattctc -3’ (обратный), вторая пара - 5’– gtyatgytytgcatacatggct -3’ (прямой) и 5’–agccgacgaaatyaattctgt c -3’ (обратный). Первый раунд ПЦР проводили совмещенно с обратной транскрипцией (ОТ), условия реакции были следующими: 42 °С – 1 час, затем 5 мин. – 94 °С (денатурация и инактивация фермента обратной транскриптазы), затем 35 циклов: 94 °С – 30 сек, 45 °С – 30 сек., 72 °С – 45 сек., финальная элонгация – 72 °С – 7 мин. Условия для второго раунда ПЦР – 35 циклов: 94 °С – 30 сек, 45 °С – 30 сек., 72 °С – 45 сек., финальная элонгация – 72 °С – 7 мин. Полученные продукты ПЦРопределяли  в 1,5%-номагарозном геле в ТВЕ. Величина продукта амплификации для ВГЕ составляла 350 п.о.

Для выделенных от кроликов изолятов ВГЕ определяли нуклеотидную последовательность амплифицированного  участка ОРС2 вирусного генома величиной 300 нуклеотидов. Для определения нуклеотидной последовательности анализируемых фрагментов вирусных геномов проводили секвенированиеампликонов. Секвенирование осуществляли с использованием набора GenomeLabTMMethodsDevelopmentKitDyeTerminatorCycleSequencing (BeckmanCoulter, США), согласно протоколу производителя. Полученные нуклеотидные последовательности фрагментов вирусных геномов выравнивали  друг с другом и с соответствующими им участками полных и частичных геномных последовательностей анализируемых вирусов, доступными в GenBank на момент проведения исследования, с помощью программы MEGA версии 5.05.

Результаты исследования и их обсуждение

Результаты выявления анти-ВГЕ IgG в образцах сыворотки крови кроликов в возрасте до 6 месяцев приведены в таблице 1. Большинство образцов сыворотки крови, полученных от кроликов в Москве и Московской области, были позитивными по анти-ВГЕ класса IgG (22/27 и 23/28 соответственно). Достоверно реже анти-ВГЕ выявляли у кроликов из Республики Беларусь (5/40, p<0,05). Анти-ВГЕ IgG являются анамнестическими, то есть указывают на имевшую место ранее встречу с ВГЕ, поэтому полученные результаты указывают на более интенсивную циркуляцию ВГЕ среди кроликов на фермах в Московской области и г.Москве по сравнению с Республикой Беларусь. Таким образом, к возрасту 6 месяцев большинство кроликов на двух из трех обследованных ферм уже встречались с ВГЕ.

Таблица 1

Частота обнаружения анти-ВГЕ класса IgG среди кроликов




N образцов

Частота выявления анти-ВГЕ (%)

г. Москва



Московская обл. (г.Электрогорск)



Республика Беларусь




По данным литературы, частота выявления анти-ВГЕ может значительно варьировать от фермы к ферме. Так, в США частота выявления анти-ВГE у кроликов от одного поставщика составляла 40%, у другого - 50% (5/10). Причем первый поставщик являлся производителем SPF кроликов [2].  На двух других фермах в штате Вирджиния (США) распространенность анти-ВГЕ у кроликов составила 36%, в Китае (провинция Ганьсу) – 55%-57% [3,12]. С одной стороны, различия между данными, полученными в разных исследованиях, могут быть связаны с различиями в чувствительности и специфичности применяемых ИФА-тестов. Однако в нашем исследовании все постановки на анти-ВГЕ выполнялись с одной тест-системой, высокая специфичность и чувствительность которой при тестировании человеческих образцов была доказана в испытаниях [5]. Поэтому различия в частоте выявления анти-ВГЕ у кроликов в разных регионах не связаны с методологией.  По-видимому, различия по частоте выявления анти-ВГЕ связаны с различиями в возрасте животных, при котором чаще происходит инфицирование. А это, в свою очередь, зависит от условий содержания животных. Вероятно, на ферме в Республике Беларусь, откуда были получены сыворотки для нашего исследования, инфицирование кроликов происходит в более поздние сроки. 

При исследовании 482 образцов фекальных экстрактов кроликов РНК ВГЕ была выявлена в 26 образцах. У животных, содержащихся в виварии на территории ФГУП «Производство института полиомиелита и вирусных энцефалитов имени М.П.Чумакова» (Москва) и имевших возраст менее 6 месяцев, РНК ВГЕ была выявлена в 13,8% (4 из 29) образцов (табл. 2). На двух фермах в Московской области (г. Электрогорск),где животные были представленыв возрастах от 2 до 10 месяцев, частота выявления РНК ВГЕ составила 10,0% (4 из 40 образцов) и  2,2% (1 из 45 образцов), соответственно. Различия между показателями были статистически значимыми (p<0,05). На  двух фермах в Республике Беларусь, где были обследованы животные в возрасте менее 6 месяцев, частота выявления РНК ВГЕ составила 11,0% (8/73) и 30,0% (9/30) (табл.2).  Различия между показателями также были статистически значимыми (p<0,05).

Таблица 2

Частота выявления РНК ВГЕ в образцах фекалий кроликов




Возраст животных

N образцов

Частота выявления РНК ВГЕ (%)

Российская Федерация


4-6 мес.



Московская область, г. Электрогорск, ферма 1

2-10 мес.



Московская область, г. Электрогорск, ферма 2

0-10 мес.





2-12 мес.





8 мес.



Свердловская область

0-12 мес.



Республика Беларусь

Ферма 1

4-6 мес.


11,0 %

Ферма 2

2-6 мес.





4-12 мес.




2-12 мес.




3-8 мес.




0-6 мес.




РНК ВГЕ в образцах фекалий кроликов из остальных регионов (Белгородская и Свердловская области РФ, Египет) выявлена не была. Поскольку в этих регионах были обследованы животные разных возрастов (от 2 до 12 месяцев), отрицательный результат поиска РНК ВГЕ отражает, скорее, истинное отсутствие циркуляции вируса на этих фермах, а не ошибки в сборе образцов.

Большинство обследованных животных имело возраст 4-6 месяцев, и среди них частота ВГЕ-инфекции варьировала от 0 до 25%. Между обследованными фермами существовали различия не только по частоте выявления ВГЕ-инфекции, но и по возрасту животных, в котором чаще выявляется ВГЕ. Так, на ферме 1 в Московской области РНК ВГЕ не была выявлена у животных моложе 6 месяцев, хотя встречалась у старших животных (6-10 месяцев). В то же время на второй ферме в этом регионе и на ферме 1 в Республике Беларусь ВГЕ-инфекция выявлялась преимущественно у животных в возрасте до 4 месяцев. Выявленные различия, по-видимому, отражают разные подходы к содержанию животных. Таким образом, большинство случаев ВГЕ-инфекции у кроликов происходит в возрасте до 6 месяцев. На это же указывает и высокая частота выявления анти-ВГЕ IgG у животных этого возраста.

Для филогенетического анализа выявленных фрагментов генома ВГЕ в базе данных GenBank нами были отобраны референсные последовательности изолятов вируса ГЕ кроликов, полученных в Китае и Франции, а также большое число последовательностей ВГЕ от человека и свиней различных генотипов и субтипов, циркулирующих в разных регионах мира. В анализ филогенетических взаимоотношений также включены выделенные ранее на территории РФ изоляты ВГЕ от людей, заболевших ГЕ (вспышка и спорадические случаи), и изоляты ВГЕ от свиней.

Результаты филогенетического анализапоказали, что выделенные нами изоляты вируса ВГЕ кроликов образовывали единый кластер со всеми известными на сегодняшний момент последовательностями ВГЕ кроликов, формируя филогруппу ВГЕ кроликов, близкую генотипу 3 ВГЕ(рис. 1).  Последовательности ВГЕ кроликов из Республики Беларусь (обозначены на рис.1 как RabbitBelor) формируют на филогенетическом дереве единую, довольно однородную группу, со степенью сходства внутри нее 98-100%. Изоляты из Московского региона формируют две независимые группы – в одну вошли два изолята из г.Москвы (78 RabbitMosc 2013  и 79 RabbitMosc 2013 на рис.1), во вторую – все остальные изоляты из Москвы и Московской области. Степень сходства между последовательностями двух групп изолятов из Московского региона – 84%, степень сходства внутри групп – 99-100%. Все три группы выявленных в нашей работе последовательностей ВГЕ кроликов группируются с китайскими изолятами ВГЕ, с ними же в группу входит и единственный опубликованный изолят ВГЕ кроликов из США. Французские изоляты ВГЕ кроликов образуют на дереве отдельную группу, различия между ними и выявленными в нашей работе последовательностями составляют 19%.

Степень сходства между московскими и белорусскими изолятами составляет 86-87%, при этом более многочисленная группа московскихизолятов имеет больше сходства с китайскими последовательностями, чем с белорусскими (89% и 86-87% соответственно). Два отдельно стоящих московских изолята, наоборот, ближе к белорусскимизолятам.

Необходимо отметить, что все последовательности ВГЕ кроликов - и выявленные в нашей работе, и опубликованные ранее - формируют отдельную группу и отличаются от последовательностей генотипа 3 ВГЕ, выделенных от людей и свиней на территории РФ и других стран, на 18-21%. В отличие от ВГЕ кроликов, последовательности ВГЕ, выделенные от свиней на территории Белгородской области (на рис. 1 обозначены Belswine), сходны с последовательностями ВГЕ, выделенными от заболевших людей в этом же регионе, и образуют с ними единыефилогруппы. Степень сходства между последовательностями ВГЕ, выделенными на территории Белгородской области от людей и от свиней, составляет 94-97%.

Рис.1.Филогенетические взаимоотношения изолятов ВГЕ, выделенных от кроликов, а также людей и свиней, по участку ОРС 2 ВГЕ (300 нт., 5996–6295 нумерация по прототипному изоляту Burme — M73128). Жирным шрифтом обозначены изоляты ВГЕ, выделенные в данной работе. Изоляты, выделенные от кроликов, обозначены Rabbit, от свиней – Swine, от людей – Human. Для обозначения региона выделения вируса использованы следующие обозначения: Республика Беларусь – Belor, Белгородская область — Bel, Московская обл. – Mosc, Архангельская область — arch, Владимирская область — vlad, Калининградская область — kalin, Саратовская область — sar, Свердловская область — ekat, Хабаровский край — khab. Для каждого изолята указан год выделения. Прототипные изоляты ВГЕ из GenBank приведены с указанием их номеров в базе данных. Числа в узлах дерева — процент bootstrap-псевдорепликатов, поддерживаемых данную группу (приведены только достоверные значения >70%). Длина ветвей отражает степень отличия нуклеотидной последовательности вирусов в соответствии с приведенной шкалой.

Таким образом, до настоящего времени на территории РФ не выявлены случаи ГЕ, ассоциированные с ВГЕ кроликов. В мире в настоящее время известен только один изолят, выделенный во Франции от заболевшего человека и относящийся, по результатам анализа геномной последовательности, к ВГЕ кроликов [6]. Поэтому данные для заключения о значении ВГЕ кроликов для инфекционной патологии человека пока ограниченны. Не исключается возможность передачи ВГЕ от кроликов человеку, аналогично хорошо документированной и доказанной передаче вируса от свиньи человеку, тем более что описаны успешные случаи экспериментального заражения приматов, а также свиней кроличьим ВГЕ [8], и кроликов штаммами ВГЕ генотипов 3 и 4 [9]. Однако полученные нами данные не поддерживают предположение о какой-либо значимой роли кроликов как резервуара ВГЕ для человека, в отличие от свиней. Аналогичным образом нами не выявлены случаи заражения свиней кроличьими вариантами ВГЕ.


·                Вирус гепатита Е кроликов выделен на территории Российской Федерации и Республики Беларусь; циркуляция этого вируса у кроликов в гиперэндемичном по гепатиту Е регионе (Египет) не установлена.

·                Вирус гепатита Е кроликов широко распространен среди кроликов в возрасте до 6 месяцев  на территории Российской Федерации и Республики Беларусь.

·                Циркулирующие в Российской Федерации и Республике Беларусь варианты ВГЕ кроликов принадлежат к геноварианту, близкому к 3 генотипу ВГЕ и объединяющему все известные последовательности ВГЕ кроликов.

·                Выделенныеизоляты ВГЕ кроликов не связаны генетически с изолятами ВГЕ человека и свиней, выделенными на тех же территориях, что не позволяет рассматривать кроликов в качестве резервуара патогенных для человека штаммов ВГЕ.


МорозовИ.А., д.м.н., профессор, заместительдиректорапонаукеФГБНУ «Институтполиомиелитаивирусныхэнцефалитов им. М.П. Чумакова», г.Москва;

МалинниковаЕ.Ю., д.м.н., заведующий кафедрой вирусологии ГБОУ ДПО «РМАПО» Минздрава России, г. Москва.