Сетевое издание
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

ОПРЕДЕЛЕНИЕ ИНФОРМАТИВНЫХ ДНК-МАРКЕРОВ ГЕНА RF1 – ВОССТАНОВИТЕЛЯ ФЕРТИЛЬНОСТИ ПЫЛЬЦЫ ЦМС PET1 ПОДСОЛНЕЧНИКА

Маркин Н.В. 1 Усатенко Т.В. 2 Усатов А.В. 1 Тихобаева В.Е. 1 Горбаченко О.Ф. 2 Кулишова Г.А. 1 Азарин К.В. 1
1 Южный федеральный университет
2 Донская опытная станция им. Л.А. Жданова ВНИИМК
В работе на селекционном материале (17 материнских ЦМС-линий и 29 отцовских Rf-линий) Донской опытной станции им. Л.А. Жданова ВНИИМК изучены 9 ДНК-маркеров – ORS 511, ORS 224, ORS 317, ORS 630, ORS 799, ORS 1030, HRG01, HRG02 и STS-115, которые, по данным литературы, составляют общую с геном Rf1 – восстановителя фертильности пыльцы ЦМС PET1 группу сцепления. Из исследованных 9 маркеров отобраны три – HRG01, HRG02 и STS-115 для идентификации гена Rf1, высокая информативность которых была подтверждена полевыми испытаниями. На основе полученных результатов разработана мультиплексная ПЦР тест-система, эффективная для идентификации маркера ядерного гена Rf1 и митохондриального локуса orfH522 (ЦМС PET1), которая может быть использована в практике маркерной селекции подсолнечника.
подсолнечник (Helianthus annuus L.)
тест-система
ЦМС
гены Rf
ДНК-маркеры
1. Маркин Н.В., Усатов А.В., Федоренко М.Г. RAPD-анализ генотипов солеустойчивых форм горчицы (Brassica juncea L.) // Экологический вестник научных центров Черноморского экономического сотрудничества. - 2006. - № 3. - С. 99-102.
2. Маркин Н.В., Тихонова М.А., Анисимова И.Н., Рожкова В.Т., Гаврилова В.А., Усатов А.В. SCAR маркер гена Rf1 подсолнечника у линий восстановителей фертильности пыльцы растений с различными типами ЦМС // Масличные культуры. Научно-технический бюллетень ВНИИМК. - Краснодар. - 2009. - Вып. 2 (141). - С. 3-5.
3. Маркин Н.В., Горбаченко О.Ф., Тихонова М.А., Усатов А.В. Кодоминантные маркеры гена Rf1 культурного подсолнечника // Масличные культуры. Научно-технический бюллетень ВНИИМК. - Краснодар. - 2010. - Вып. 1 (142-143). - С. 3-8.
4. Horn R., Kusterer B., Lazarescu E., Prufe M., Friedt W. Molecular mapping of the Rf1 gene restoring pollen fertility in PET1-based F1 hybrids in sunflower (Helianthus annuus L.) // Theor. Appl. Genet. - 2003. - Vol. 106. - P. 599-606.
5. Horn R. Recombination: Cytoplasmic male sterility and fertility restoration in higher plants // Progress in Botany. - 2006. - Vol. 67. - P. 31-52.
6. Kohler T., Horn R., Lossl A., Zetsche K. Cytoplasmic male sterility in sunflower is correlated with the co-transcription of a new open reading frame with the atpA gene // Mol. Gen. Gen. - 1991. - Vol. 262. - № 2. - P. 283-290.
7. Yu J. K., Tang S., Slabaugh M. B., Heesacker A., Cole G., Herring M., Soper J., Ham F., Chu W. C., Webb D. M., Thompson L., Edwards K. J., Berry S., Leon A. J., Olungu C., Maes N. and Knapp S. J. Towards a saturated molecular genetic linkage map for cultivated sunflower // Crop Sci. – 2003. - V. 43. - P. 367-387.
8. Yue B., Vick B.A., Cai X., Hu J. Genetic mapping for the Rf1 (fertility restoration) gene in sunflower (Helianthus annuus L.) by SSR and TRAP markers // Plant Breeding. - 2010. - Vol. 129. - P. 24-28.

Введение

Подсолнечник - одна из основных масличных сельскохозяйственных культур, востребованных в народном хозяйстве. Одним из главных направлений селекции подсолнечника является получение гетерозисных гибридов. В коммерческом производстве доминируют гетерозисные гибриды, полученные на основе цитоплазматической мужской стерильности ЦМС РЕТ1. В восстановлении фертильности пыльцы ЦМС PET1 участвуют два доминантных ядерных гена. Один из них присутствует в генотипах большинства линий-закрепителей стерильности, а другой – Rf1 – должен быть введен в генотип гибридного потомства [5]. Поиск новых генотипов, несущих ген Rf1, актуально для получения родительских форм. В связи с этим остро стоит проблема быстрого и точного определения носителей генов Rf1 в генофонде этой культуры. В настоящее время процесс идентификации Rf1 – генотипов проводят классическим гибридологическим анализом, который длителен и трудоемок. Он включает проведение в поле скрещиваний и оценку фертильности пыльцы растений F1 на стадии цветения.

В связи с тем что данные о точной локализации гена Rf1 на генетической карте подсолнечника и его нуклеотидной последовательности в литературе не приведены, то одним из возможных способов его идентификации является использование ДНК-маркеров, ассоциированных с признаком восстановления фертильности пыльцы. Ранее для определения гена Rf1 подсолнечника у линий восстановителей фертильности пыльцы растений с различными типами ЦМС нами была исследована диагностическая ценность маркера HRG01 [2]. Также была изучена особенность амплификации и последовательность нуклеотидов этого маркера - HRG01 [3]. В настоящей работе мы расширили выборку тестируемых селекционных линий и увеличили количество ДНК-маркеров гена Rf1 c целью выбора наиболее информативных для их дальнейшего использования в гибридной селекции подсолнечника.

Материалы и методы исследований

Объектами исследования служили 17 ЦМС-линий и 29 Rf-линий подсолнечника селекции Донской опытной станции им. Л.А. Жданова ВНИИМК.

Поиск информативных ДНК-маркеров гена-восстановителя фертильности пыльцы (Rf1) проводили по 9 ДНК-мишеням, которые, исходя из данных литературы, на генетической карте подсолнечника находятся вблизи Rf1-гена (табл. 1).

Таблица 1

Маркеры, использованные для идентификации гена Rf1

Название маркера

Последовательность нуклеотидов праймеров

Источник

Размер фрагментов, п.н.

ORS 511

f- TGGCTCAGATTAAGTTCACACAG

r- CGGGTTGCGAGTAACAGGTA

[7]

155, 180

ORS 224

f- AACCAAAGCGCTGAAGAAATC

r- TGGACTAACTACCAGAAGCTAC

134, 110

ORS 317

f- TTTGGCAGTTTGGTGGCTTA

r- GGTCGTATGCTTAATTCTTTCTCT

160

ORS 630

f- GCACGACCCGGATATGTAAC

r- TGTGCTGAGGATGATATGCAG

346

ORS 799

f- ACTCCCTCCCATTCTCGTCT

r- TCCAGCAAGTCAGCAACAAC

142

ORS 1030

f- CCTTTGATGTAGTTAAGGAAGTTGTG

r- CGATCAATTTATATGACCGAATTACC

430

HRG01

f- TATGCATAATTAGTTATACCC

r- ACATAAGGATTATGTACGGG

[4]

 

454

HRG02

f- AAACGTGGGAGAGAGGTGG

r- AAACGTGGGCTGAAGAACTA

740

STS-115

f- CGAACTAATCATCATACAACCA

r- TCGGCTCTTATGTATGTTCAC

[8]

115, 370

Выделение геномной ДНК и ПЦР-анализ проводили согласно описанным методикам [1; 3]. Реакцию амплификации проводили в термоциклере Palm Cycler (Corbett Research, Австралия) по четырем программам: 1) один цикл: 10 мин. 94 °С; 35 циклов: 45 сек. 94 °С, 45 сек. 65 °С, 1 мин. 72 °С, один цикл: 6 мин. 72 °С (для HRG02), 2) один цикл: 5 мин. 95 °С; 35 циклов: 15 сек. 95 °С , 30 сек. 58 °С, 25 сек. 72 °С один цикл: 1 мин. 72 °С (для HRG01), 3). один цикл: 2 мин. 96 °С; 30 циклов: 30 сек. 94 °С , 40 сек. 55 °С, 1 мин. 72 °С, один цикл: 2 мин. 72 °С (для STS-115), 4) один цикл: 2 мин. 96 °С; 30 циклов: 30 сек. 94 °С , 40 сек. 58 °С, 1 мин. 72 °С, один цикл: 2 мин. 72 °С (для остальных маркеров).

Для разработки дизайна праймеров использовали программу PrimerQuestSM от Integrated DNA Technologies, Inc.

Результаты исследования и их обсуждение

В полевых условиях все отобранные 17 ЦМС-линий и 29 Rf-линий были исследованы на наличие/отсутствие гена Rf1. Было подтверждено, что все ЦМС-линии характеризуются мужски стерильной цитоплазмой и рецессивным гомозиготным (rf1rf1) состоянием гена-восстановителя фертильности пыльцы, а все Rf-линии по результатам тест-кроссов – стерильным цитоплазмоном и доминантным гомозиготным (Rf1Rf1) состоянием гена-восстановителя фертильности пыльцы.

Результаты ПЦР анализа продемонстрировали, что SSR-маркеры – ORS 317, ORS 630, ORS 799, ORS 1030 одинаково представлены как у линий-восстановителей фертильности пыльцы (Rf1Rf1), так и у ЦМС-линий (rf1rf1). Следовательно, данные SSR-маркеры не ассоциированы с признаком мужской фертильности, т.е. не информативны для идентификации гена Rf1 в генотипе подсолнечника.

В электрофоретических спектрах продуктов амплификации маркера – ORS 511 у ЦМС-линий ВД 1448,ЭД 169, ВД 344, ВД 151, ЭД 236, ВД 354, ВД 255, ВД 149 был визуализирован фрагмент размером около 180 п.н., который не встречается у других изученных линий. У ЦМС-линий: ВД 22, ЭД 869, ЭД 77, ЭД 95, ВД 350, ВД 356, ЭД 73; ЭД 931, J-10/544 и всех изученных линий-восстановителей детектирован фрагмент размером около 155 п.н. (рис. 1).

Примечание: 1-17 – ЦМС-линии (rf1rf1): 1- ВД 1448; 2 - ЭД 169; 3 - ВД 344; 4 - ВД 22; 5 - ЭД 869; 6 - ВД 151; 7 - ЭД 236; 8 - ЭД 77; 9 - ЭД 95; 10 - ВД 354; 11 - ВД 255; 12 - ВД 350; 13 - ВД 356; 14 - ВД 149; 15 - ЭД 73; 16 - ЭД 931; 17 – J-10/544; 18-47 - линии-восстановители фертильности пыльцы (Rf1Rf1): 18 – J-7/0306; 19 – J-8/361; 20 – J-8/7307; 21 – J-8/515; 22 – J-8/543; 23 – J-9/1228; 24 – J-9/1671; 25 - ВД 541; 27 - ВД 62; 28 - ВД 110; 29 – J-8/991; 30 - ЭД 788; 31 - ЭД 195; 32 - ЭД 114; 33 - ЭД 538; 34 – J-9/941152; 35 – J-8/0123; 36 – J-8/843; 37 – J-8/2288; 38 – J-7/40181; 39 – J-6/1854; 40 – J-7/90592; 41 – J-6/3867; 42 – J-6/70165; 43 – J-6/507; 44 – J-8/0211; 45 – J-7/698; 46 – J-9/4917; 47 – J-9/99017. 26 – отрицательный контроль. M – маркер молекулярной массы 1 Kb DNA Ladder (Fermentas), На рисунке отмечены фрагменты (около 180 п.н), амплифицированные у некоторых линий ЦМС.

Рисунок 1. Электрофоретические спектры продуктов амплификации маркера ORS 511

Другой электрофоретический спектр получен после амплификации маркера ORS 224. Так, у ЦМС-линий: ЭД 169, ВД 22, ЭД 869, ВД 151, ЭД 77, ЭД 95, ВД 354 амплифицирован фрагмент размером около 110 п.н., а у ЦМС-линий: ВД 1448, ВД 344, ЭД 236, ВД 255, ВД 350, ВД 356, ВД 149, ЭД 73, ЭД 931, J-10/544 и всех изученных Rf-линий – фрагмент размером около 134 п.н. Следовательно, маркеры ORS 511 и ORS 224 также не информативны для идентификации гена Rf1. Однако эти два маркера могут быть использованы для генотипирования и генетической паспортизации ЦМС-линий, так как демонстрируют полиморфный электрофоретический спектр продуктов их амплификации.

Высокоинформативными в идентификации Rf1-генотипов явились маркеры – HRG01, HRG02 и STS-115 (рис. 2).

Примечание: 1-17 – ЦМС-линии (rf1rf1); 18-46 - линии-восстановители фертильности пыльцы (Rf1Rf1) (названия линий приведены выше, рис. 1). 47 – отрицательный контроль. M – маркер молекулярной массы 1 Kb DNA Ladder (Fermentas). На рисунке выделены фрагменты, информативные для идентификации Rf- и ЦМС-линий.

Рисунок 2. Электрофоретические спектры продуктов амплификации маркеров: А – HRG01, Б – HRG02 и В – STS-115

В результате амплификации HRG01 и HRG02 у всех исследованных Rf-линий обнаружены фрагменты размером около 454 п.н. и 740 п.н. соответственно, тогда как у ЦМС-линий эти ПЦР-маркеры отсутствуют. Праймеры маркера STS-115 у всех изученных 36 линий подсолнечника инициировали синтез фрагмента размером около 115 п.н., и, кроме этого, у всех ЦМС-линий дополнительно визуализируется еще один фрагмент размером около 370 п.н.

Таким образом, результаты ПЦР-анализа свидетельствуют об идентификационной ценности маркеров HRG01, HRG02 и STS-115 для определения гена Rf1 в генотипе подсолнечника.

Одной из практических задач маркерной селекции является создание информативных и простых в использовании диагностических тест-систем. В связи с этим нами была разработана мультиплексная ПЦР тест-система, позволяющая в одной реакционной смеси идентифицировать наличие/отсутствие маркера гена-восстановителя фертильности пыльцы – Rf1, так и митохондриального локуса – orfH522. Так как известно, что митохондриальная ДНК стерильных растений с ЦМС PET1 отличается от митохондриальной ДНК фертильных форм наличием инверсии 11 т.н. и инсерции 5 т.н., приводящих к появлению новой открытой рамки считывания orfH522, которая транскрибируется вместе с геном atpA и кодирует белок 16 кДа [6].

Для разработки такой тест-системы была использована нуклеотидная последовательность маркера гена Rf1 – HRG01, определенная нами ранее [3], и последовательность нуклеотидов митохондриальной открытой рамки считывания – orfH522 (база данных NCBI GenBank, http://www.ncbi.nlm.nih.gov/nuccore/X55963.1).

На основании данных последовательностей нуклеотидов были созданы специфические праймеры для проведения мультиплексной ПЦР. Праймеры конструировали таким образом, чтобы амплификация маркеров системы ЦМС PET1-Rf1 осуществлялась с равной эффективностью. Испытания мультиплексной тест-системы показали, что она информативна для амплификации как маркера гена Rf1 – восстановителя фертильности, так и orfH522 ЦМС PET1.

Спектром практического применения разработанной мультиплексной ПЦР тест-системы может быть: а) идентификация генотипов на этапах получения родительских линий для гетерозисной селекции подсолнечника, б) оценка генетической чистоты линейного материала по признаку фертильности/стерильности пыльцы (уменьшение объема полевых работ), в) поиск новых доноров гена Rf1 восстановителя фертильности пыльцы ЦМС PET1 у сортов, а также диких видов.

Заключение

Таким образом, из 9 испытанных ДНК-маркеров – ORS 511, ORS 224, ORS 317, ORS 630, ORS 799, ORS 1030, HRG01, HRG02 и STS-115, которые, по данным литературы, составляют общую с геном Rf1 группу сцепления, отобраны три маркера - HRG01, HRG02 и STS-115 информативные для идентификации гена Rf1 – восстановителя фертильности пыльцы ЦМС PET1. Разработана мультиплексная ПЦР тест-система, эффективная для определения маркера ядерного гена Rf1 и митохондриального локуса orfH522 (ЦМС PET1), которая может быть использована в маркерной селекции подсолнечника.

Исследование выполнено в рамках темы Министерства образования и науки РФ (№ 4.5642.2011) и при финансовой поддержке ФЦП Министерства образования и науки РФ (госконтракт № 16.740.11.0485).

Рецензенты:

Михайлов Н.В., д-р с-х наук, заведующий лабораторией молекулярной диагностики и биотехнологии НИИ биоинформатики, биотехнологии и живых систем ДГАУ, п. Персиановский, Ростовская область.

Шкурат Т.П., д-р биол. наук, профессор, директор НИИ биологии ЮФУ, г. Ростов-на-Дону.


Библиографическая ссылка

Маркин Н.В., Усатенко Т.В., Усатов А.В., Тихобаева В.Е., Горбаченко О.Ф., Кулишова Г.А., Азарин К.В. ОПРЕДЕЛЕНИЕ ИНФОРМАТИВНЫХ ДНК-МАРКЕРОВ ГЕНА RF1 – ВОССТАНОВИТЕЛЯ ФЕРТИЛЬНОСТИ ПЫЛЬЦЫ ЦМС PET1 ПОДСОЛНЕЧНИКА // Современные проблемы науки и образования. – 2013. – № 4. ;
URL: https://science-education.ru/ru/article/view?id=9822 (дата обращения: 06.12.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074