Сетевое издание
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

ОЦЕНКА СPG-МЕТИЛИРОВАНИЯ ГЕНОВ APC И P16 У ПАЦИЕНТОК С ДИАГНОСТИРОВАННЫМ РАКОМ ЯИЧНИКОВ

Вереникина Е.В. 1 Меньшенина А.П. 1 Адамян М.Л. 1 Арджа А.Ю. 1 Кечерюкова М.М. 1
1 ФГБУ «Национальный медицинский исследовательский центр онкологии» Минздрава России
Аберрантное метилирование CpG-островков в регуляторных областях генома считается важным механизмом канцерогенеза, включая рак яичников (РЯ). Целями настоящего исследования были оценка статуса метилирования генов-онкосупрессоров АРС и p16 в опухолевых образцах пациенток с диагнозом «рак яичников» и определение их прогностического значения. В исследование были включены 78 женщин в возрасте 27–70 лет с первичным диагнозом «рак яичников T1-3сN0-1M0-1 (стадия II-IV)». Количественный анализ CpG-метилирования APC и P16 был проведен методом пиросеквенирования. В исследовании 43 образца РЯ (55%) продемонстрировали CpG-гиперметилирование хотя бы по одному гену, 35 из них (45%) были гиперметилированы по двум генам одновременно. В подгруппе гиперметилированных опухолей отмечено статистически достоверное повышение уровня CpG-метилирования APC и P16 в 4,5 (р<0,0001) и 5,6 (p=0,002) раза соответственно. Уровень метилирования не зависел от возраста больных. Одновременное гиперметилирование опухоли по АРС и Р16 повышает в 4 раза риск рецидивирования заболевания в течение последующих 48 месяцев (RR=4,06; CI% 2,149–7,668). Таким образом, у пациенток с диагнозом «рак яичников» уровень метилирования промотора АРС и гена Р16 в опухолевой ткани достоверно увеличен относительно условно нормальной (р<0,000, p=0,002, соответственно) в 36,0% и 45,0% случаев. В случаях одновременного гиперметилирования опухоли по АРС и P16 обнаружена достоверная ассоциация с повышенным риском рецидивирования заболевания. Поэтому использование двух эпигенетических маркеров может быть эффективно для прогнозирования течения заболевания.
рак яичников
метилирование
apc
p16
1. Krushkal J., Silvers T., Reinhold W.C., Sonkin D., Vural S., Connelly J., Varma S., Meltzer P.S., Kunkel M., Rapisarda A., Evans D., Pommier Y., Teicher B.A. Epigenome-wide DNA methylation analysis of small cell lung cancer cell lines suggests potential chemotherapy targets. Clin Epigenet. 2020. Vol. 12. Р. 93. DOI: 10.1186/s13148-020-00876.
2. Кит О.И., Водолажский Д.И., Тимошкина Н.Н., Пржедецкий Ю.В., Хохлова О.В. Молекулярная биология семейных случаев меланомы человека // Вопросы онкологии. 2015. Т. 61. № 6. С. 889-897.
3. Кит О.И., Гвалдин Д.Ю., Трифанов В.С., Колесников Е.Н., Тимошкина Н.Н. Молекулярно-генетические особенности нейроэндокринных опухолей поджелудочной железы // Генетика. 2020. Т.56. № 2. С. 142-160. DOI: 10.31857/S001667582002006X.
4. Гвалдин Д.Ю., Омельчук Е.П., Тимошкина Н.Н., Трифанов В.С., Сидоренко Ю.С. Современные представления о молекулярных механизмах в онкогенезе гастроинтестинальных стромальных опухолей // Вопросы онкологии. 2020. Т. 66. № 1. С. 13-22.
5. Moselhy S.S., Kumosani T.A., Kamal I.H., Jalal J.A., Jabaar H.S., Dalol A. Hypermethylation of P15, P16, and E-cadherin genes in ovarian cancer. Toxicol Ind Health. 2015. Vol. 31 (10). P. 924 930.
6. Natanzon Y., Goode E.L., Cunningham J.M. Epigenetics in ovarian cancer. Semin Cancer Biol. 2018; 51: 160-169. doi:10.1016/j.semcancer.2017.08.003
7. Engqvist H., Parris T.Z., Biermann J., Ronnerman E.W., Larsson P., Sundfeldt K., Kovacs A., Karlsson P., Helou K. Integrative genomics approach identifies molecular features associated with early-stage ovarian carcinoma histotypes. Sci Rep. 2020. Vol. 10 (1). P. 7946. DOI: 10.1038/s41598-020-64794-8.
8. Pisanic T.R., Wang Y., Sun H., Considine M., Li L., Wang T-H, Wang T-L, Shih I-M. Methylomic Landscapes of Ovarian Cancer Precursor Lesions. Clin Cancer Res. 2020. Vol. 26. P. 6310-6320. DOI: 10.1158/1078-0432.CCR-20-0270.
9. Reid B.M., Permuth J.B., Sellers T.A. Epidemiology of ovarian cancer: a review. Cancer biology & medicine. 2017. Vol. 14. P. 9 32. DOI: 10.20892/j.issn.2095-3941.2016.0084.
10. Кит О.И., Водолажский Д.И., Двадненко К.В., Ефимова И.И., Олейникова Е.Н., Олейников Д.Д., Тимошкина Н.Н. Аберрантное метилирование промоторных участков генов APC, CDH13 и MGMT у больных колоректальным раком // Сибирский онкологический журнал. 2016. Т. 15. № 2. С. 48-55.
11. Timoshkina N.N., Kit O.I., Vodolazhskiy D.I., Soldatkina N.V., Gevorkyan Y.A., Samoylenko N.S., Kharagezov D.A.,. Duritskiy M.N, Dashkov A.V., Kaymakchi D.O., Petrov D.S., Ilchenko S.A., Sustretov V.A., Vladimirova L.Y.. Changes in CpG methylation of APC, CDH13, MLH1, MGMT, P16 and RASSF1A in gastric adenocarcinoma. Annals of Oncology. 2018. Vol. 29. Suppl.8. P. 648.
12. Eskander R.N. The Epigenetic Landscape in the Treatment of Gynecologic Malignancies. American Society of Clinical Oncology educational book. American Society of Clinical Oncology. Annual Meeting. 2018. Vol. 38. P. 480 487. DOI: 10.1200/edbk_200203.
13. Кит О.И., Водолажский Д.И., Колесников Е.Н., Тимошкина Н.Н. Эпигенетические маркеры малигнизации тканей пищевода: метилирование ДНК // Биомедицинская химия. 2016. Т. 62. № 5. С. 520-526.
14. Mahmood N., Rabbani S.A. DNA methylation readers and cancer: mechanistic and therapeutic applications. Front Oncol. 2019. Vol. 9. P. 489.
15. Koukoura O., Spandidos D. A., Daponte A., Sifakis S. DNA methylation profiles in ovarian cancer: implication in diagnosis and therapy (Review). Molecular medicine reports. 2014. Vol. 10. P. 3 9. DOI: 10.3892/mmr.2014.2221.
16. Teschendorff A.E., Menon U., Gentry-Maharaj A., Ramus S.J., Gayther S.A., Apostolidou S., Jones A., Lechner M., Beck S., Jacobs I.J., Widschwendt M. An Epigenetic Signature in Peripheral Blood Predicts Active Ovarian Cancer. PLoS ONE. 2009. Vol. 4 (12). P. e8274. DOI: 10.1371/journal.pone.0008274.
17. Stefanski C.D., Prosperi J.R. Wnt-Independent and Wnt-Dependent Effects of APC Loss on the Chemotherapeutic Response. Int J. Mol Sci. 2020. Vol. 21 (21). P. 7844. DOI: 10.3390/ijms21217844.
18. Shen C., Sheng Q., Zhang X., Fu Y., Zhu K. Hypermethylated APC in serous carcinoma based on a meta-analysis of ovarian cancer. J. Ovarian Res. 2016. Vol. 9 (1). P. 60. DOI: 10.1186/s13048-016-0271-6.
19. Gao S.J., Zhang G.F., Zhang R.P. High CpG island methylation of p16 gene and loss of p16 protein expression associate with the development and progression of tetralogy of Fallot. J. Genet. 2016. Vol. 95. P. 831 837.
20. Zuberi M., Dholariya S., Khan I., Mir R., Guru S., Bhat M., Sumi M., Saxena A. Epigenetic Silencing of DAPK1and p16INK4a Genes by CpG Island Hypermethylation in Epithelial Ovarian Cancer Patients. Ind J. Clin Biochem. 2021. Vol. 36. P. 200 207. DOI: 10.1007/s12291-020-00888-4.

Рак яичников (РЯ) – относительно редкая онкопатология с внушительным грузом генетических изменений, обусловливающих как наследственные, так и спорадические случаи заболевания, что дает возможность прогнозировать генетические риски для определения стратегий лечения, в том числе раннего хирургического вмешательства [1–4]. Эпигенетическая составляющая в виде метилирования ДНК может играть важную роль в патогенезе РЯ. Согласно современным представлениям онкогенная трансформация инициируется благодаря совместному репрограммированию генома и эпигенома, что приводит к изменению экспрессии генов [5].

Аналогично опухолям различных локализаций уровень метилирования ДНК в РЯ демонстрирует глобальное гипометилирование с областями фокального гиперметилирования, чаще в промоторах классических опухолевых супрессоров и генов репарации. В то же время отмечена гистотип-ассоциированная специфичность рисунка метилирования при РЯ [6, 7]. Метилирование ДНК в норме служит барьером для клеточного репрограммирования и онкогенеза. Аберрантное метилирование может быть результатом соматических эпимутаций, которые возникают и накапливаются в течение жизни, или/и «конституционных» эпимутаций, индуцированных в раннем эмбриогенезе. Исследования, привлекающие возможности NGS-технологии, позволили выявить высокоспецифичное дифференциальное метилирование генома как при РЯ, так и на предраковых стадиях, что доказывает ранние изменения эпигенома и возможность потенциального их использования в качестве биомаркеров [8]. В итоге специфичность эпигенетического профиля ДНК опухоли может помочь разделить пациентов на группы риска, рецидива, ответа на химиотерапию и прогноза [1, 9].

Цель исследования. В настоящем исследовании были изучены уровни метилирования промоторных участков генов-онкосупрессоров APC и P16 в опухолевой ткани яичника по сравнению с условно нормальной тканью.

Материалы и методы исследования

В исследование были включены 78 женщин в возрасте 27–70 лет с первичным диагнозом «рак яичников T1-3сN0-1M0-1, гр. 2 (стадия II-IV)», проходивших плановое лечение в ФГБУ «НМИЦ онкологии» Минздрава России в 2015–2019 гг. По морфологической структуре преобладали серозные карциномы низкой и высокой степени злокачественности. Все пациентки подписали информированное согласие на обработку персональных данных и передачу сведений, составляющих врачебную тайну, и на передачу биологического материала.

Материалом исследования служили образцы ДНК, экстрагированные из парафиновых блоков опухолевой и условно здоровой ткани, как описано ранее [10]. Количественный анализ CpG-метилирования промоторных участков генов-онкосупрессоров APC и P16 был проведен методом пиросеквенирования бисульфит-конвертированной ДНК согласно [10]. Для определения метилирования семи CpG-сайтов в позициях с +148 по +182 гена Р16 использовали набор праймеров PyroMark Q24 CpG р16. По результатам пробных экспериментов для наработки ампликонов, специфичных по отношению к промотору гена АРС, и собственно для пиросеквенирования были выбраны праймеры: F - 5’ biotin – tttttgtttgttggggatt 3’; R ‑ 5’ actacaccaatacaaccacatatc 3’; seq - 5’ acacaactacttctctctcc 3’. Дизайн праймеров был осуществлен в программе MethPrimer 2.0. Праймеры были подобраны на основе бисульфит-конвертированных последовательностей, содержащих специфичные CpG-сайты. Первичную обработку пирограмм проводили в программе PyroMark. Показатель Меt (%) для каждого образца рассчитывали как медиану показателей метилирования CpG-сайтов трех повторов.

Статистическую обработку данных проводили с помощью непараметрических критериев (медианы, интерквартильного интервала, коэффициента Манна–Уитни). Критический уровень значимости при проверке статистических гипотез принимали равным 0,05.

Результаты исследования и их обсуждение

Показатели уровня CpG-метилирования (Меt, %) для каждого гена представлены в таблице 1.

Таблица 1

Метилирование (Met) CpG-локусов APC и Р16 в условно нормальной и опухолевой тканях у пациенток с РЯ

Ген

Группа

n (%)

Медиана Меt , %

Интерквартильный интервал Меt , %

Достоверность различий уровней Меt по сравнению с условно нормальной тканью в

U-тесте, p

Достоверность различий уровней Меt в группах Met_H и Met_L в

U-тесте, p

APC

N

78 (100)

4

2,0

6,0

 

 

Met-H

28 (36)

18

11,8

35,8

6,04; p<0,000

 

Met-L

60 (64)

4

2,0

8,0

0,32; p=0,749

3,5; p<0,000

C

78 (100)

5,8

 

 

 

 

P16

N

78 (100)

3

1,0

5,0

 

 

Met-H

35 (45)

23,5

16,0

42,9

4,89; p<0,000

 

Met-L

43 (65)

4.5

8,2

10,5

3,13; p=0,002

3,1; p<0,001

C

78 (100)

8

 

 

 

 

Примечание: N – условно нормальная ткань (норма); Met-H – образцы опухоли с Met, превышающим 10%; Met-L – образцы опухоли с Met, не превышающим 10%; C – образцы опухоли суммарно.

Во всех образцах условно нормальной ткани был зарегистрирован «фоновый» уровень метилированных участков исследованных генов, составивший для промотора АРС 4%, для 1 экзона Р16 – 3%.

Опухолевые образцы продемонстрировали гетерогенность – по каждому гену зафиксированы случаи как гиперметилирования, так и незначительного метилирования (подгруппы Met-H и Met-L соответственно). В подгруппе Met-H отмечено статистически достоверное повышение уровня CpG-метилирования APC и P16 в 4,5 и 5,6 раза соответственно. Более того, метилирование промоторных участков генов в подгруппе Met-Н было статистически достоверно выше, чем в подгруппах условно нормальной ткани, и Met-L по всем генам при высоком уровне значимости (p<0,001). В группу Met-L по гену Р16 вошли образцы опухоли с метилированием не выше 10%, однако и это позволило дифференцировать ее от условно нормальной ткани.

В целом, 43 образца РЯ (55%) продемонстрировали CpG-гиперметилирование хотя бы по одному гену, 35 из них (45%) были гиперметилированы по двум генам одновременно.

В течение жизни метилирование генома меняется постоянно под влиянием окружающей среды и генетической предрасположенности. С возрастом происходит падение уровня ДНК-метилирования, но локально увеличение транскрипционной репрессии генов-супрессоров опухолей, что определило введение термина «эпигенетические часы» как одного из механизмов старения. В настоящем исследовании определение ассоциаций возраста пациенток с уровнем метилирования CpG-сайтов не выявило значимой корреляции (р=0,385 для АРС, р=0,489 для Р16). Ранее было показано отсутствие ассоциаций между возрастными, гендерными, гистологическими показателями и статусом CpG-метилирования генов APC и P16 в неопластических образованиях толстой кишки и желудка [10, 11].

В ретроспективной группе из 78 пациенток, вошедших в исследование, в 36% случаев развился рецидив в интервале от 7 до 48 месяцев наблюдения. На рисунке 1 проиллюстрировано влияние статуса метилирования АРС и Р16 на частоту рецидивов у пациенток с РЯ после проведения предусмотренного комплексного лечения. Неблагоприятный исход заболевания наблюдали у 68% пациенток в группе с гиперметилированием промотора АРС и у 56% пациенток в группе с гиперметилированием Р16.

При этом одновременно гиперметилирование АРС и Р16 было обнаружено у 19 из 28 пациенток с рецидивом. Дальнейший анализ продемонстрировал относительно сильную связь между развитием неблагоприятных событий у больных РЯ и эпигенетическими изменениями АРС, Р16 (OR=12,365, CI95% 12,4–34,2). В итоге наличие гиперметилирования АРС и Р16 в опухоли повышает в 4 раза риск рецидивирования в течение последующих 48 месяцев. Использование двух маркеров может быть эффективно для прогнозирования заболевания (Se = 67,9%, Sp= 85,4%).

Анализ статуса CpG-островков исследованных сайтов в злокачественных опухолях яичника различных стадий по классификации TNM продемонстрировал некоторое повышение уровня метилирования, однако наблюдаемый тренд не был статистически значим, возможно, из-за недостаточного объема выборки.

Рис. 1. Частота неблагоприятных событий у пациенток с разным статусом метилирования АРС и Р16 (Мet-H – гиперметилирование, Met-N – нет значимого метилирования)

Несмотря на достижения в исследовании опухолевой микросреды и геномной гетерогенности в сочетании с многочисленными клиническими испытаниями новых лекарственных средств, 5-летняя относительная выживаемость, составляющая при распространенном раке яичников около 30–40%, практически не улучшилась за последние два десятилетия [9]. Эпигенетическая регуляция оказалась важным дополнительным механизмом, влияющим на инициацию и развитие рака яичников, который добавляет еще одно измерение для стратификации пациентов в целях определения тактики лечения [9, 12].

Фенотип аберрантного «метилирования» был описан для многих гематологических и солидных злокачественных новообразований, где он обусловливает дерегуляцию сигнальных путей, контролирующих развитие, дифференцировку, клеточный цикл, ДНК репарацию, апоптоз [9, 13, 14].

В настоящем исследовании было выявлено дифференциальное метилирование между условно нормальной тканью яичника и РЯ (табл. 1). Этот факт имеет потенциальную ценность для скрининга группы риска развития РЯ. Считается, что изменение метилирования ДНК происходит на ранних стадиях развития опухолей, способствуя канцерогенезу, и, таким образом, эти данные могут быть использованы в качестве скрининговых панелей биомаркеров. Ранее Pisanic c соавторами идентифицировал панель из трех генов (c17orf64, IRX2 и TUBB6) с паттернами метилирования, которые различают нормальные и опухолевые образцы [8]. Другие исследователи в своих работах выявили гены, промоторы которых гиперметилированы в образцах РЯ (E-кадгерин или CDH1, H-кадгерин, BRCA1, RASSF1A, APC, p14 ARF, p16INK4A, DAPK, RUNX3, TFPI2, SFRP5 и OPCM), имеют лучшую чувствительность и специфичность, чем CA-125, некоторые даже обнаруживаются в сыворотке или плазме [15, 16].

Ген аденоматозного полипоза толстой кишки (APC), известный опухолевый супрессор, расположен на длинном плече 5-й хромосомы (5q21-q22). Исследования APC обычно были сосредоточены на мутациях, вызывающих семейный аденоматозный полипоз. Однако гиперметилирование, которое является одним из ключевых эпигенетических изменений последовательности APC, также связано с канцерогенезом при различных формах рака [10, 11]. Одним из наиболее известных механизмов реализации онкосупрессорной функции APC служит регуляция сигнального пути Wnt / β- catenin [17]. В выборке из 78 пациенток нами было выявлено гиперметилирование CpG-островков в промоторном участке APC в 28 случаях (36%). При этом достоверных различий между подгруппой Met-H (Met <10%) и условно нормальной тканью не обнаружено. Ранее на основе метаанализа данных 12 исследований было показано отсутствие существенной ассоциации между гиперметилированием промотора APC и стадией серозного РЯ [18]. В настоящей работе статус метилирования промотора АРС был достоверно связан с частотой неблагоприятных событий.

P16INK4 (также известный как CDKN2A), классический онкосупрессор, расположен на хромосоме 9p21 и играет важную роль в регуляции клеточного цикла путем замедления перехода клеток от фазы G1 к S. Известно, что экспрессия Р16 снижается путем метилирования ДНК [19]. Кроме того, инактивация P16 активирует белок ретинобластомы (RB) путем стимуляции циклинзависимых киназ (CDK) и пути RB, что приводит к нарушению клеточной пролиферации и апоптоза, тем самым еще больше способствуя канцерогенезу. Действительно, некоторые виды рака, включая рак яичников, демонстрируют фенотип метилирования Р16 [12, 20]. В наборах данных Atlas Genome Atlas уровни метилирования семи из девяти сайтов CpG были значительно повышены в тканях опухоли яичника по сравнению с нормальными тканями.

В настоящем исследовании образцы злокачественных неоплазий яичников продемонстрировали повышенный уровень метилирования 1 экзона Р16. Все 78 образцов были гиперметилированы или демонстрировали повышенный уровень значения Меt относительно контроля. В этом случае выделение гиперметилированной группы актуально для оценки прогностической значимости маркера. Результаты настоящего исследования показали, что именно в группе Мet-H (гиперметилированного P16, Met >0%) частота неблагоприятных событий была значимо выше.

Выводы

Таким образом, у пациенток с диагнозом «рак яичников» уровень метилирования промотора АРС и гена Р16 в опухолевой ткани достоверно увеличен относительно условно нормальной ткани (р<0,000 и p=0,002 соответственно) в 36,0% и 45,0% случаев. В случаях одновременного гиперметилирования опухоли по АРС и P16 обнаружена достоверная ассоциация с повышенным риском рецидивирования заболевания.


Библиографическая ссылка

Вереникина Е.В., Меньшенина А.П., Адамян М.Л., Арджа А.Ю., Кечерюкова М.М. ОЦЕНКА СPG-МЕТИЛИРОВАНИЯ ГЕНОВ APC И P16 У ПАЦИЕНТОК С ДИАГНОСТИРОВАННЫМ РАКОМ ЯИЧНИКОВ // Современные проблемы науки и образования. – 2021. – № 4. ;
URL: https://science-education.ru/ru/article/view?id=30992 (дата обращения: 18.10.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074