Сетевое издание
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

ГЕНЕТИЧЕСКИЕ И ЭПИГЕНЕТИЧЕСКИЕ ПРЕДИКТОРЫ ЭФФЕКТИВНОСТИ ЛУЧЕВОЙ ТЕРАПИИ ОПУХОЛЕЙ ПРЯМОЙ КИШКИ

Кутилин Д.С. 1 Гусарева М.А. 1 Кошелева Н.Г. 1 Павлятенко И.В. 1 Савченко Д.А. 1 Габричидзе П.Н. 1 Гварамия А.К. 1 Шляхова О.В. 1 Бабенков О.Ю. 1
1 ФГБУ "Национальный медицинский исследовательский центр онкологии" Министерства здравоохранения Российской Федерации
Радиорезистентность опухолевых клеток, приводящая к неполному ответу опухоли на лечение, в настоящее время остается главной проблемой лучевой терапии злокачественных опухолей прямой кишки. За последние 30 лет был предложен ряд молекулярных маркеров в качестве предикторов ответа на лучевую терапию, однако ни один из них не вошел в клиническую практику. Соответственно, скрининг подобных маркеров остается актуальной задачей, для решения которой необходимо интегрировать данные по различным типам биомаркеров, полученным при проведении лучевой терапии по унифицированной схеме. Поэтому целью исследования стал поиск маркеров радиорезистентности опухолей прямой кишки на основании данных по вариации числа копий генов, экспрессии генов и микроРНК. В исследование было включено 75 больных раком прямой кишки и 30 условно-здоровых доноров. Лучевая терапия проводилось по схеме РОД = 2,4 Гр до СОД = 54 Гр на линейном ускорителе частиц Novalis TX. Показатели экспрессии генов и микроРНК определяли в образцах биопсии, показатель копийности – в образцах биопсии и внеклеточной ДНК методом Real-Time qPCR. Было показано, что эффективность лучевой терапии связана с аберрантной экспрессией 13 микро-РНК (miRNA-130b, miRNA-1249, miRNA-6820, miRNA-6757, miRNA-1273h, miRNA-6737, miRNA-6819, miRNA-557, miRNA-6874, miRNA-4728, miRNA-6808, miRNA-3202, miRNA-5195), которые обеспечивают эффективную регуляцию системы репарации ДНК (BRC-A2, H2AX и RBBP-8) и регуляцию апоптоза (CASP-9 и BCL-2). В свою очередь экспрессия генов, таргетируемых этими микроРНК, также может выступать в роли маркера чувствительности к лучевой терапии. В ходе исследования была подтверждена взаимосвязь между экспрессией и копийностью генов, что позволяет использовать показатель копийности генетических локусов CASP-9, BCL-2, BRCA-2, H2AX и RBBP-8 также в качестве предикторов эффективности лучевой терапии в образцах биопсии, а показатель копийности генов H2AX и RBBP-8 – в качестве маркеров эффективности лучевой терапии во внДНК больных раком прямой кишки.
копийность генов
экспрессия генов
микроРНК
лучевая терапия
радиорезистентность
апоптоз
репарация днк
1. Кутилин Д.С., Гусарева М.А., Кошелева Н.Г., Габричидзе П.Н., Донцов В.А., Легостаев В.М., Шляхова О.В., Лиман Н.А., Солнцева А.А., Васильева Е.О. Влияние аберрантной экспрессии микроРНК на эффективность лучевой терапии опухолей прямой кишки // Современные проблемы науки и образования. 2020. № 6; URL: http://www.science-education.ru/ru/article/view?id = 30384 (дата обращения: 15.04.2021).
2. Romano G.M., Bianco F., De Franciscis S., Belli A. The Management of Recurrent Rectal Cancer: A European Perspective. In: Kwaan M., Zbar A. (eds) Comprehensive Rectal Cancer Care. Springer, Cham; 2019. P. 521–536.
3. Li X.F., Jiang Z., Gao Y., Li C.X., Shen B.Z. Combination of three-gene immunohistochemical panel and magnetic resonance imaging-detected extramural vascular invasion to assess prognosis in non-advanced rectal cancer patients. World J. Gastroenterol. WJG. 2016. V. 22. P. 8576–8583.
4. Sun W., Li G., Wan J., Zhu J., Shen W., Zhang Z. Circulating tumor cells: A promising marker of predicting tumor response in rectal cancer patients receiving neoadjuvant chemo-radiation therapy. Oncotarget. 2016. V. 7 (43). P. 69507–69517.
5. Водолажский Д.И., Кутилин Д.С., Солдатова К.И. Изучение стабильности экспрессии референсных генетических локусов при малигнизации тканей толстой кишки // 5-я итоговая научная сессия молодых учёных РостГМУ: сборник материалов ФГБОУ ВО РостГМУ Минздрава России. Ростов н/Д: изд-во РостГМУ, 2018. С. 33–34.
6. Kutilin D.S. Regulation of gene expression of cancer/testis antigens in colorectal cancer patients. Molecular Biology. 2020. V. 54 (4). P. 520–534.
7. Balcells I., Cirera S., Busk P.K. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers. BMC biotechnology. 2011. V. 11 (1). P. 70.
8. Krishnan A., Zhang R., Yao V., Theesfeld C.L., Wong A.K., Tadych A., Volfovsky N., Packer A., Lash A., Troyanskaya O.G. Genome-wide prediction and functional characterization of the genetic basis of autism spectrum disorder. Nature Neuroscience. 2016. V. 19 (11). P. 1454–1462.
9. Ding J., Li X., Hu H. TarPmiR: a new approach for microRNA target site prediction. Bioinformatics. 2016. V. 32 (18). Р. 2768–2775.
10. Backes C., Khaleeq Q.T., Meese E., Keller A. miEAA: microRNA enrichment analysis and annotation. Nucleic Acids Res. 2016. V. 44 (W1). P. W110- W116.
11. Greene C.S., Krishnan A., Wong A.K., Ricciotti E., Zelaya R.A., Himmelstein D.S., Zhang R., Hartmann B.M., Zaslavsky E., Sealfon S.C., Chasman D.I., FitzGerald G.A., Dolinski K., Grosser T., Troyanskaya O.G. Understanding multicellular function and disease with human tissue-specific networks. Nature Genetics. 2015. DOI: 10.1038/ng.3259w.
12. Urbańska K., Orzechowski A. Unappreciated Role of LDHA and LDHB to Control Apoptosis and Autophagy in Tumor Cells. Int. J. Mol. Sci. 2019. V. 20 (9). P. 2085.
13. Scully R., Xie A. Double strand break repair functions of histone H2AX./ Mutat. Res. 2013. V. 750 (1–2). P. 5–14.
14. Abdelsattar Z.M., Wong S.L., Regenbogen S.E., Jomaa D.M., Hardiman K.M., Hendren S. Colorectal cancer outcomes and treatment patterns in patients too young for average-risk screening. Cancer. 2016. V. 122. P. 929–934.
15. Bryzgunova O.E., Laktionov P.P. Extracellular nucleic acids in urine: sources, structure, diagnostic potential. Acta Naturae. 2015. V. 7 (3). P. 48–54.
16. Кошелева Н.Г., Гусарева М.А., Удаленкова И.А., Фатькина Н.Б., Легостаев В.М., Шляхова О.В., Лиман Н.А., Карнаухова Е.А., Крохмаль Ю.Н., Кутилин Д.С. Показатель копийности генов во внеклеточной днк плазмы крови как маркер для малоинвазивной оценки эффективности лучевой терапии опухолей прямой кишки // Современные проблемы науки и образования. 2020. № 6. URL: http://www.science-education.ru/ru/article/view?id=30396 (дата обращения: 15.04.2021).

Среди всех онкологических заболеваний в мире рак прямой кишки (РПК) занимает одну из лидирующих позиций по показателю летальности: в 2020 г. было зарегистрировано более 310 тыс. смертей от данной патологии [1].

Лучевая терапия (ЛТ) при РПК применяется для облегчения симптомов и локального контроля заболевания [2]. Протоколы ЛТ РПК сильно изменились за последнее десятилетие, но полный клинический ответ достигается лишь у небольшого числа пациентов. Главная причина плохого ответа опухолей на ЛТ – формирование радиорезистентности злокачественных клеток. За последние 30 лет был предложен значительный перечень молекулярных маркеров для предсказания ответа на ЛТ, однако ни один из них так и не вошёл в клиническую практику в 2021 г. Данное обстоятельство связано с неполнотой проведенных ранее исследований, которые оценивали лишь определенный класс биомаркеров (либо генетических, либо протеомных, либо эпигенетических), не оценивали эффективность, специфичность и чувствительность этих маркеров, а также использовали неунифицированные схемы лучевой терапии и были выполнены на незначительных по объему и неоднородных выборках [3; 4]. Всё это подчеркивает необходимость проведения комплексного сравнения и интегрирования различных типов молекулярных маркеров, полученных при проведении ЛТ по унифицированной схеме.

Поэтому целью исследования стал поиск маркеров радиорезистентности опухолей прямой кишки на основании данных по вариации числа копий генов, экспрессии генов и микроРНК.

Материалы и методы исследования

Клиническая характеристика пациентов. В исследование было включено 75 пациентов (16 женщин, 59 мужчин) с диагностированным РПК (возраст 31–81 год, медиана возраста 59,8±5 лет), проходивших в 2019–2021 гг. стационарное лечение в ФГБУ «НМИЦ онкологии», а также 30 условно-здоровых индивидуумов (без онкологической патологии). Выборку гистологически подтвержденных опухолей составили аденокарциномы (21 % локальные (T3N0M0), а 79 % – с метастазами в регионарные лимфатические узлы (T3N1-2M0)). ЛТ проводилось на линейном ускорителе частиц Novalis TX (разовая очаговая доза (РОД) 2,4 Гр до суммарной очаговой дозы (СОД) 54,0 Гр). Для выделения ДНК и РНК использовали парные фрагменты биопсии условно-нормальных и опухолевых тканей прямой кишки, полученные при видеоколоноскопии (ВКС) до ЛТ.

Экстракция РНК, оценка экспрессии генов и микро-РНК. Образец ткани гомогенизировали методом механического воздействия с добавлением тризола (QIAzol, Qiagen). Выделение тотальной РНК проводили с помощью набора RNeasy Plus Universal Kits (Qiagen) по инструкции, предоставленной производителем. Для устранения контаминации геномной ДНК выделенную РНК обрабатывали ДНКазой-1. Реакцию синтеза комплементарной ДНК (кДНК) осуществляли при помощи набора «РЕВЕРТА-Л» (Интерлабсервис, Россия) по инструкции, предоставленной производителем.

Методом ПЦР в реальном времени (Real-Time qPCR, RT-qPCR) проводили оценку относительной экспрессии двадцати семи генов (табл. 1). Стабильность экспрессии для подбора референсных генов (GAPDH, ACTB и B2M) оценивали с помощью алгоритма, описанного нами ранее [5]. Высокоспецифичные синтетические олигонуклеотиды (праймеры) были разработаны с использованием программы Primer-3 и базы данных GenBank (National Center for Biotechnology Information) (табл. 1).

Таблица 1

Синтетические олигонуклеотиды для определения экспрессии генов

Праймеры

Последовательности праймеров

Праймеры

Последовательности праймеров

1

BRCA1(F)

ACCTGTCTCCACAAAGTGTGA

30

BRIP1(R)

CTCATCTGCTGGTTTCCCACT

2

BRCA1(R)

ACACTGTGAAGGCCCTTTCT

31

CDK1(F)

AAGCCGGGATCTACCATACC

3

BRCA2(F)

AGTTGGCTGATGGTGGATGC

32

CDK1(R)

CATGGCTACCACTTGACCTGT

4

BRCA2(R)

GGATCCACACCTGGAGTGTC

33

CDKN1B(F)

TAATTGGGGCTCCGGCTAAC

5

PTEN(F)

GGCACAAGAGGCCCTAGATA

34

CDKN1B(R)

GAAGAATCGTCGGTTGCAGGT

6

PTEN(R)

CATAGCGCCTCTGACTGGG

35

CCND1(F)

GATCAAGTGTGACCCGGACT

7

CASP3(F)

CTGGAATATCCCTGGACAACAGT

36

CCND1(R)

CTTGGGGTCCATGTTCTGCT

8

CASP3(R)

TCGACATCTGTACCAGACCGA

37

CCND3(F)

GTGGAGACTGGCTCTGTTCG

9

CASP8(F)

CTGAAGCAAACAGCCAGTGC

38

CCND3(R)

TCACATACCTCCTCGTCAGGT

10

CASP8(R)

GACCTCAATTCTGATCTGCTCAC

39

FGFR2(F)

AACAGTCATCCTGTGCCGAA

11

GAPDH(F)

GTCAAGGCTGAGAACGGGAA

40

FGFR2(R)

TGGACTCAGCCGAAACTGTTA

12

GAPDH(R)

TCGCCCCACTTGATTTTGGA

41

KU70(F)

ACGTAGAGGGCGTTGATTGG

13

BAX(F)

GGGACGAACTGGACAGTAACA

42

KU70(R)

TGGCTACTGCTCACTTTGGC

14

BAX(R)

GCTGCCACTCGGAAAAAGAC

43

RAD50(F)

GCGTGCGGAGTTTTGGAATAG

15

B2M(F)

AGATGAGTATGCCTGCCGTG

44

RAD50(R)

TTGAGCAACCTTGGGATCGT

16

B2M(R)

CCATGATGCTGCTTACATGTCTC

45

RAP80(F)

GAGTGAGCAGGAAGCTAGGG

17

BCL-2(F)

GGATCCAGGATAACGGAGGC

46

RAP80(R)

AGAAGGCCGGCAACTATTCA

18

BCL-2(R)

GAAATCAAACAGAGGCCGCA

47

RB1 (F)

TTGTAACGGGAGTCGGGAGA

19

CASP-9(F)

TGAGACCCTGGACGACATCT

48

RB1 (R)

TCAAACTCAAGCCTGACGAGA

20

CASP-9(R)

TCCCTTTCACCGAAACAGCA

49

Rif1 (F)

GGCTGTTTCCATCGGTCACT

21

P53(F)

TTGGAACTCAAGGATGCCCA

50

Rif1 (R)

CATACGACTGGTCAGAGTCAGG

22

P53(R)

CGGGAGGTAGACTGACCCT

51

RNF168(F)

GCCAGTTCGTCTGCTCAGTA

23

MDM2(F)

TAGGAGATTTGTTTGGCGTGC

52

RNF168(R)

CTGCCGCCACCTTGCTTAT

24

MDM2(R)

CCTGCTGATTGACTACTACCAA

53

TGFB1(F)

TGGACATCAACGGGTTCACTAC

25

AKT1(F)

ATCGAACGCACCTTCCATGT

54

TGFB1(R)

CCATGAGAAGCAGGAAAGGC

26

AKT1(R)

AAACTCGTTCATGGTCACGC

55

TopBP1(F)

CCAACGAGTTCAGAAATGTCCAG

27

ATM(F)

TGCGTGGCTAACGGAGAAAA

56

TopBP1(R)

AACGCCACTAAAAGGGTCACA

28

ATM(R)

ATCACTGTCACTGCACTCGG

57

ACTB(F)

AACCGCGAGAAGATGACCC

29

BRIP1(F)

TTACCCGTCACAGCTTGCTA

58

ACTB(R)

AGCACAGCCTGGTAGCAAC

Реакцию амплификации проводили в смеси, состоящей из 1х ПЦР-буфера, 0,2 мМ dNTP, 1,5 мМ MgCl2, 0,6 мМ синтетических олигонуклеотидов, 0,1 U/мкл Taq-полимеразы и 15 нг комплементарной ДНК. Смесь инкубировали в Real-Time термоциклере Bio-Rad CFX 96 при следующих температурных условиях: 94 °С – 240 с и далее 39 повторов (циклов): 94 °С – 9 с, 57 °С – 25 с, 72 °С – 45 с. Относительную экспрессию генетических локусов (RЕ) рассчитывали по формуле RЕ = E-ΔΔCt, учитывающей нормализацию по генам референсным генам (GAPDH, ACTB и B2M) и уровню мРНК соответствующих генов-мишеней в образцах нормальной ткани. Схема нормализации была следующей: 1 – расчёт среднего геометрического C(t) референсных генов; 2 – вычисления дифференциальной разницы порогового цикла (ΔC(t)): C(t)target–C(t)reference; 3 – медианы ΔC(t) каждого гена-мишени для условно-нормальной и опухолевой ткани; 4 – вычисление отношения ΔC(t) медиана опухолевой ткани /ΔC(t)Медиана нормальной ткани (ΔΔC(t)); 5 – вычисление окончательного результата E-ΔΔC(t).[6].

С помощью баз данных (MirTarBase, miRDB и TargetScan) были отобраны микро-РНК, ассоциированных с чувствительностью опухолевых клеток к ЛТ. В качестве референсной микроРНК использовали U6. Алгоритм Balcells I. использовали для разработки синтетических олигонуклеотидов. Выделенную суммарную РНК использовали в реакции обратной транскрипции со специфичными RT-праймерами, одновременно с полиаденилированием [7]. Изменение относительной экспрессии микроРНК также оценивали методом RT-qPCR.

Экстракция ДНК и определение вариаций числа копий генов (CNV). ДНК экстрагировали из фенол-хлороформной фазы реагента QIAzol (Quagen) по протоколу производителя. Из плазмы крови проводили выделение внеклеточной опухолевой ДНК (внДНК) при помощи набора «ДНК-Плазма-М» (Тест-Ген, Россия). Принцип выделения внДНК с использованием данного набора состоит в обратимом связывании нуклеиновых кислот на поверхности магнитных частиц, после чего следуют этапы инкубаций, отмывок, высушивания и элюции (рис. 1). Перед использованием набора была проведена пред-подготовка образцов крови, 10 мл которой смешивали с 3 мл фосфатного буфера (рН 7,5) и центрифугировали 20 мин при 1500 об/мин и температуре 10 °С, разделяя, таким образом, плазму и фракцию клеток.

Для определения вариаций числа копий генов (CNV) были разработаны последовательности 37 пар синтетических олигонуклеотидов, включая 3 пары для референсных генетических локусов ACTB, B2M и GAPDH (табл. 2). Для дизайна праймеров использовали собственный скрипт на языке R и базу данных NCBI GenBank. CNV определяли методом RT-qPCR в трех технических повторах. Относительную копийность (RCN) рассчитывали по формуле RCNx = 2-ΔC(t), где ΔC(t) = C(t)исследуемого гена – C(t)референсного гена, вычисляли медиану RCNоп опухолевых образцов и медиану RCNнорм нормальных для каждого гена и соотношение: RCNоп/RCNнорм.

Статистический и биоинформационный анализ выполняли на языке R в среде RStudio версии 8.10.173.987. Нормальность распределения оценивали с помощью критерия Шапиро – Уилка (n < 50), значимость межгрупповых различий определяли с использованием критерия Манна – Уитни (поправка Бонферрони), анализ взаимосвязей исследуемых показателей проводили с использованием коэффициента корреляции Спирмена (r).

Рис. 1. Схема экстракции внДНК из плазмы крови

Для кластерного анализа использовали параметры Hierarchical Clustering и Euclidean distance. Группировку генетических локусов по выполняемым ими биологическим функциям осуществляли с помощью алгоритма FMD (Functional module detection). Q-value вычисляли с помощью одностороннего точного критерия Фишера (поправка Бенджамини – Хохберга) [8]. Биоинформационный поиск микроРНК осуществляли по реверсированному алгоритму TarPmiR, в основе которого лежит алгоритм машинного обучения random forest (объединяет метод случайных подпространств и метод бэггинга Бреймана), позволяющий прогнозировать сайт связывания матричной РНК и микроРНК [9].

Таблица 2

Последовательности синтетических олигонуклеотидов для определения вариаций числа копий генов

Название олигонуклеотида

Последовательности олигонуклеотидов

Праймеры

Последовательности олигонуклеотидов

1

AKT1_F

ATGGACAGGGAGAGCAAAGT

38

Rif1_R

TCCAAAGTCTCCAACAGCGG

2

AKT1_R

TGATGCACCAGCTGACAGG

39

RNF168_F

TGAGGGGAGGAGAGGACTTG

3

ATM_F

GCAAAACCAAATGTATCAGCCTCA

40

RNF168_R

AGGCAAACAGGAATACCCCG

4

ATM__R

GACCAAACTACTGATTTCCTGCAT

41

TGFB1_F

TTGAGACTTTTCCGTTGCCG

5

BRIP1_F

GAAGAACTTGTCAGCCTGGGG

42

TGFB1_R

GAGGGCTGGTCCGGAATG

6

BRIP1_R

TCTTGTATTAGTTCTCGGGCTGTG

43

TopBP1_F

TGGGCGGACGAGTATACAGA

7

BRCA1_F

GTAGCCCCTTGGTTTCCGTG

44

TopBP1_R

AGGTTTCTTCAGGTTTGCAGC

8

BRCA1_R

CCCTTTCCCGGGACTCTACT

45

TP53_F

GGTCGGTGGGTTGGTAGTTT

9

BRCA-2_F

TGCATCCCTGTGTAAGTGCAT

46

TP53_R

GTGTGGGATGGGGTGAGATT

10

BRCA-2_R

ACGTACTGGGTTTTTAGCAAGC

47

XRCC4_F

CAGACTTGGTTCCTTCAACCT

11

CDK1_F

CAGGGGATTGTGTTTTGTCACT

48

XRCC4_R

TCTGCAGGTGCTCATTTTTGG

12

CDK1_R

ACCACTATTCCACTTGCCTCAT

49

BAX_F

GCCTCCTCTCCTACTTTGGG

13

CDKN1B_F

TCGGGGTCTGTGTCTTTTGG

50

BAX_R

AAACACAGTCCAAGGCAGC

14

CDKN1B_R

CTCCCGTTAGACACTCGCAC

51

CASP8_F

TCTTTATGATATTGGGGAACAACTG

15

CCND1_F

GGTGAACAAGCTCAAGTGGAAC

52

CASP8_R

GTTCTTGCTTCCTTTGCGGA

16

CCND1_R

CCGGCCAGGGTCACCTAA

53

CASP3_F

ATGCAGCAAACCTCAGGGAA

17

CCND3_F

TTCCACGGTTGCTACATCGT

54

CASP3_R

TTCACCATGGCTCAGAAGCA

18

CCND3_R

ACACAGCAGCTCCATACTCG

55

CASP-9_F

CTCCACTTCCCCTGAAGACG

19

EXO1_F

GTTACCCGTGTTCTGCGTTG

56

CASP-9_R

CTGGGTGTGGGCAAACTAGA

20

EXO1_R

GAACCCACCCATTAGCCTCC

57

MDM2_F

TCTTTGGGACCCATCTACCCT

21

FGFR2_F

CAAGGACCACTCTTCTGCGT

58

MDM2_R

AGAATGCTTTAGTCCACCTAACCTT

22

FGFR2_R

CTTGAATGGCAACGCTCCTC

59

BCL-2_F

GAGTGGGATGCGGGAGATG

23

HIST1 H2_F

CGTGCTACTGCCCAAGAAGA

60

BCL-2_R

GGTGAAGGGCGTCAGGTG

24

HIST1 H2_R

AGCCTTTGGTTCCTTTGGGAT

61

RBBP-8_F

ACCGAGGATTTGGCACTCTG

25

H2AX_F

AGGCCTCCCAGGAGTACTAA

62

RBBP-8_R

TCCGAGATTGCCTCGGGATT

26

H2AX_R

CTGAAGCGGCTCAGCTCTTT

63

EP300_F

TCGGCGAATTTGTGCTCTTG

27

KU70_F

AAGATCATAAGCAGTGATCGAGA

64

EP300_R

CCTTTTTCTCTTCGCCGGGT

28

KU70_R

TCCAGCTCCTGTAAGACGTA

65

LIG4_F

GGGTAAAGGATCACGGGGTG

29

PTEN_F

GTCCAGAGCCATTTCCATCCT

66

LIG4_R

CCAGACCCAACACGAGAGAG

30

PTEN_R

TGTCATGTCTGGGAGCCTGT

67

C-FLIP_F

GGCTCCCAGAGTGTGTATGG

31

RAD50_F

TGGCTGGCAGGATCTTTTGG

68

C-FLIP_R

GGCCCTCTGACACCACATAG

32

RAD50_R

GCTTAACTGAGGCCGAAGCA

69

GAPDH_F

GCTGAACGGGAAGCTCACT

33

RAP80_F

CAGATGTACTGGCCACTCGG

70

GAPDH_R

GCAGGTTTTTCTAGACGGCAG

34

RAP80_R

CAGTGCCTAGATGTGTCCCC

71

ACTB_F

CACCCTGAAGTACCCCATCG

35

RB1_F

TCCGGTTTTTCTCAGGGGAC

72

ACTB_R

TGTAGAAGGTGTGGTGCCAG

36

RB1_R

CAGCGAGCTGTGGAGGAG

73

B2M_F

TGAGTGCTGTCTCCATGTTTGA

37

Rif1_F

GGCTGTTTCCATCGGTCACT

74

B2M_R

ATTCTCTGCTCCCCACCTCT

Для оценки участия дифференциально экспрессирующихся микроРНК в ключевых клеточных сигнальных путях проводили ORA (Over-Representation Analysis). Статистическую значимость в ORA рассчитывали с применением точного критерия Фишера [10].

Результаты исследования и их обсуждение

Эффективность ЛТ у больных РПК и аберрантная экспрессия генов. Данные по экспрессии 27 генетических локусов в образцах биопсии опухолевой ткани прямой кишки использовали в кластерном анализе (параметры [Hierarchical Clustering&Euclidean distance]), позволившем определить наличие двух крупных кластеров, соответствующим двум группам пациентов. В первой группе у 79 % пациентов была повышена экспрессия гена CASP9, у 95 % снижена экспрессия генов BCL-2, BRCA-2, H2AX и RBBP-8. Во второй группе у 100 % пациентов снижена экспрессия CASP-9 и у 91 % повышена экспрессия BCL-2, BRCA-2, H2AX и RBBP-8.

Генетические локусы также были разделены на кластеры по выполняемым функциям: 1) регуляция репарации ДНК (BRCA-2, H2AX, RBBP-8), 2) регуляция реализации проапоптозных сигналов (CASP-9), 3) ингибирование проапоптозных сигналов (BCL-2). Межгенные взаимодействия и их сила, вычисленные с помощью алгоритма GIANT [11], представлены на рис. 2. С помощью другого биоинформационного алгоритма, основанного на методе машинного обучения Gene Multiple Association Network Integration, были оценены особенности взаимодействия между генетическими локусами (определена функция конкретного локуса в составе сложной сигнальной сети из множества генетических локусов) CASP-9, BCL-2, BRCA-2, H2AX, RBBP-8 и SPO-11, FKBP-8, RAD-50, SPGF-25, PNCA3, CASP-6, BRCA-1, MND-1, APPL-1, MRE-11A, NBN, TP-53, BP-1, RAD-51, MDC-1, DFNA64, APAF-1, BIK, ATM, CMM6, AGEL (табл. 3).

Таблица 3

Межгенные взаимодействия для локусов BCL-2, BRCA-2, H2AX, CASP-9, RBBP-8.

Ген

Индекс

Функция

RBBP-8

0.6478

Регуляция клеточного цикла, уровня повреждения ДНК и репарации ДНК

BRCA-2

0.6189

Регуляция гомологичной рекомбинации

H2AFX

0.5411

Контроль клеточного цикла и конформации ДНК, контроль уровня повреждения ДНК и регуляция репарации ДНК, регуляция клеточного ответа на ионизирующее излучение

BCL-2

0.5340

Регуляция апоптотоза в ответ на повреждение ДНК и воздействие радиации

CASP-9

0.5034

Активация эндопептидазы цистеинового типа, запуск апоптоза и клеточный ответ на воздействие радиации

 

Из представленных в табл. 3 функций генов ключевыми являются регуляция апоптоза и репарации ДНК, изменение конформации ДНК и регуляция клеточного цикла.

Рис. 2. Визуализация межгенного взаимодействия, его направленности и силы для локусов CASP-9, BCL-2, BRCA-2, H2AX и RBBP-8 в тканях прямой кишки

Очевидно, что в силу ингибирования репарационной системы ДНК (BRCA-2, H2AX, RBBP-8) и повышения чувствительности к стресс-индуцированному апоптозу (аберрантная экспрессия CASP-9 и BCL-2) воздействие ЛТ должно быть более эффективным в первой группе, чем во второй группе. Это предположение подтвердил анализ результатов ЛТ 75 больных РПК.

Так, у 20 больных РПК был зафиксирован полный ответ на ЛТ. При этом в опухолевом биопсийном материале у этих пациентов экспрессия H2AX и RBBP-8 была снижена в 3,30 и 2,50 раза (р < 0,005), а экспрессия CASP-9 повышена в 4,80 раза (р < 0,005). У 30 больных РПК был зафиксирован частичный ответ на ЛТ, а у 25 больных – отсутствие ответа на ЛТ вообще. При этом в опухолевом биопсийном материале у этих пациентов статистически значимо (р < 0,005) была повышена экспрессия BCL-2, BRCA-2, H2AX, RBBP-8 в 3,30; 2,00; 7,00 и 7,50 раза соответственно и снижена экспрессия CASP-9 в 4,4 раза (рис. 3).

Таким образом, можно сделать вывод, что транскрипционный профиль локусов BCL-2, BRCA-2, H2AX, CASP-9 и RBBP-8 ассоциирован с эффективностью ЛТ, которая возрастает у больных РПК с гиперэкспрессией CASP-9 и гипоэкспрессией H2AX и RBBP-8, и, наоборот эффективность ЛТ падает при гиперэкспрессии генов BCL-2, H2AX, RBBP-8 и BRCA-2.

Рис. 3. Транскрипционный профиль опухолевой ткани в двух группах больных РПК (с полным регрессом – группа 1, незначительным регрессом или его отсутствием – группа 2) * – статистически значимые отличия относительно условно-нормальной ткани прямой кишки (р < 0,005), ** – межгрупповые статистически значимые отличия (р < 0,005)

Экспрессия микроРНК и эффективность ЛТ РПК. МикроРНК являются важнейшими регуляторами уровня матричных РНК (мРНК), осуществляя регуляцию их трансляции и деградации путем взаимодействия с комплементарными участками нетранслируемых регионов их молекул [1]. С помощью модифицированного биоинформационного алгоритма TarPmiR были выявлены 1338 микроРНК таргетирующих гены BCL-2, BRCA-2, H2AX, CASP-9 и RBBP-8. Из этих микроРНК только 86 были валидированы в базе данных miRDB (рис. 4), в том числе 26 микроРНК, образующие наиболее прочные комплексы с соответствующими генами-мишенями (минимальная свободная энергия взаимодействия в паре микроРНК-мРНК): 9 микроРНК для гена BCL-2, 2 микроРНК для BRCA-2, 12 микроРНК для CASP-9, 2 микроРНК для H2AX и 1 микроРНК для гена RBBP-8 (табл. 4).

Таблица 4

МикроРНК, выявленные с использованием алгоритма TarPmiR*

Микрорнк

Ref_Seq_id

Ген-мишень

Координаты в геноме

Энергия

Участок связывания

miRDB

начало

конец

miRNA-1249-5p

NM_000633

BCL-2

3468

3517

-30.1

3`UTR

+

miRNA-6861-5p

NM_000633

BCL-2

3474

3513

-29.6

3`UTR

+

miRNA-8052

NM_000633

BCL-2

4393

4412

-29.3

3`UTR

+

miRNA-324-3p

NM_000633

BCL-2

4680

4700

-28.6

3`UTR

+

miRNA-6820-3p

NM_000633

BCL-2

1670

1701

-28.1

3`UTR

+

miRNA-4717-5p

NM_000633

BCL-2

2322

2364

-28.0

3`UTR

+

miRNA-3943

NM_000633

BCL-2

2750

2774

-27.8

3`UTR

+

miRNA-557

NM_000633

BCL-2

2549

2584

-27.6

3`UTR

+

miRNA-4690-5p

NM_000633

BCL-2

2147

2172

-27.3

3`UTR

+

miRNA-6757-3p

NM_000059

BRCA-2

10786

10812

-25.7

3`UTR

+

miRNA-7151-3p

NM_000059

BRCA-2

10797

10825

-25.1

3`UTR

+

miRNA-6779-5p

XM_011542273

CASP-9

1482

1537

-34.3

3`UTR

+

miRNA-1273h-5p

NM_032996

CASP-9

2555

2590

-33.1

3`UTR

+

miRNA-6812-5p

NM_001229

CASP-9

2593

2622

-30.6

3`UTR

+

miRNA-6737-5p

NM_032996

CASP-9

1329

1347

-30.1

3`UTR

+

miRNA-661

XM_011542273

CASP-9

1516

1552

-29.8

3`UTR

+

miRNA-6799-5p

NM_032996

CASP-9

2609

2656

-29.7

3`UTR

+

miRNA-6893-5p

NM_032996

CASP-9

2442

2484

-28.5

3`UTR

+

miRNA-6819-5p

NM_032996

CASP-9

1329

1347

-27.0

3`UTR

+

miRNA-6874-5p

NM_001278054

CASP-9

2505

2535

-26.6

3`UTR

+

miRNA-4728-5p

NM_001229

CASP-9

2906

2925

-26.3

3`UTR

+

miRNA-6808-5p

NM_032996

CASP-9

1588

1610

-26.2

3`UTR

+

miRNA-30b-3p

XM_011542273

CASP-9

1967

1987

-25.6

3`UTR

+

miRNA-3202

NM_002105

H2AFX

620

639

-20.3

3`UTR

+

miRNA-5195-3p

NM_002105

H2AFX

1478

1504

-23.8

3`UTR

+

miRNA-130b-3p

NM_002894

RBBP-8

3196

3215

-23.7

3`UTR

+

* – представлены только микроРНК валидированные в базе данных miRDB с минимальной свободной энергией взаимодействия микроРНК-мРНК.

Для этих 26 микроРНК проведено определение их экспрессии в тканях у больных РПК. Обнаружена дифференциальная экспрессия ряда микроРНК как межгрупповая, так и относительно нормальной ткани.

Рис. 4. МикроРНК и их гены-мишени (выявлены с использованием TarPmiR, валидированы в miRDB)

В группе больных с незначительным регрессом опухоли/отсутствием динамики после ЛТ (n = 55, группа с плохим ответом на ЛТ) обнаружено статистически значимое (p < 0,005) снижение экспрессии miRNA-1249-5p и miRNA-6820-3p в 2,21 и 2,04 раза соответственно относительно нормальной ткани, снижение экспрессии miRNA-6820-3p в 1,80 раза относительно пациентов с полным регрессом опухоли, снижение экспресии miRNA-4717-5p, miRNA-3943 и miRNA-557 в 2,51; 3,33 и 2,50 раза соответственно относительно нормальной ткани, снижение экспрессии miRNA-557 в 2,25 раза относительно пациентов с полным регрессом опухоли (n = 20, группа с полным ответом на ЛТ). Также обнаружено статистически значимое (p < 0,05) увеличение экспрессии miRNA-4690-5p в 2,1 раза относительно нормальной ткани. Экспрессия miRNA-4717-5p также снижена в 1,67 раза (р < 0,05) относительно нормальной ткани у пациентов с полным регрессом опухоли (рис. 5).

miRNA-3943, miRNA-1249, miRNA-6820, miRNA-4717 и miRNA-557, таргетирующие ген BCL-2, в опухолевой ткани у больных с плохим ответом на ЛТ преимущественно гипоэкспрессированы как относительно нормальной ткани, так и относительно опухолевой ткани пациентов с полным ответом на ЛТ. Соответственно, сниженная экспрессия этих микроРНК может приводить к увеличению экспрессии гена BCL-2, продукт которого ингибирует активность каспаз и, как следствие, апоптоз [12]. Данное обстоятельство согласуется с показанным на рис. 3, то есть эффектом увеличения экспрессии гена BCL-2 у пациентов с плохим ответом на ЛТ.

У больных второй группы экспрессия miRNA-6757 в опухолевой ткани статистически значимо (p < 0,05) ниже, в 5,00 раз и 4,40 раза относительно собственной нормальной ткани и опухолевой ткани пациентов с полным ответом на ЛТ соответственно. Ген BRCA-2 является мишенью данной микроРНК, и её снижение должно приводить к увеличению экспрессии этого гена (рис. 3). Экспрессия miRNA-1273h, miRNA-6737, miRNA-661, miRNA-4728, miRNA-30b и miRNA-6808 статистически значимо (p < 0,05) снижена в 2,5; 3,3; 1,7; 5,0; 1,8 и 5,0 раза соответственно в опухолевой ткани пациентов с полным ответом на ЛТ относительно нормальной ткани.

Рис. 5. Экспрессионный профиль микроРНК у больных РПК с полным регрессом опухоли или его отсутствием. * – статистически значимые отличия относительно нормальной ткани (р < 0,05), ** – межгрупповые статистически значимые отличия (р < 0.005)

У больных РПК группы 1 (полный ответ на ЛТ) выявлены статистически значимые (p < 0,05) изменения в экспрессии микроРНК miRNA-3202 и miRNA-5195. Так, в опухолевой ткани экспрессия miRNA-3202 была в 4,50 раза выше, чем в нормальной ткани, и в 3,00 раза выше, чем экспрессии в опухолевой ткани у больных РПК группы 2. Экспрессия miRNA-5195 была в 1,81 раза выше по сравнению с нормальной тканью и в 3,59 раза выше, чем экспрессия в опухолевой ткани у больных РПК группы 2 (рис. 5). Эти две микроРНК таргетируют мРНК H2AFX гистонового белка H2AX, который запускает процесс изменения конформации хроматина при повреждении ДНК под воздействием ЛТ [13]. Поэтому гипер-экспрессия miRNA-3202 и miRNA-5195 может способствовать гипоэкспрессии H2AX, и наоборот.

В опухолевой ткани у больных РПК с плохим ответом на ЛТ обнаружено статистически значимое (p < 0,05) увеличение экспрессии miRNA-1273h в 2,30 раза, miRNA-4728 в 4,00 раза, miRNA-6819 в 2,90 раза, miRNA-6737 в 3,00 раза, miRNA-6874в 3,30 раза и miRNA-6808-5p в 5,00 раз относительно опухолевой ткани пациентов с полным ответом на ЛТ. При этом экспрессия miRNA-6812 статистически значимо (p < 0,005) снижена в опухолевой ткани пациентов групп с полным и плохим ответом на ЛТ в 1,9 и 1,7 раза соответственно относительно нормальной ткани прямой кишки. CASP9 является геном-мишенью данных микроРНК, а их высокий уровень экспрессии приводит к снижению уровня мРНК каспазы-9 (инициаторной каспазы), необходимой для инициации апоптозного каскада.

Также в ходе проведенного исследования установлено, что в опухолевой ткани у больных группы 1 статистически значимо (p < 0,05) увеличивается экспрессия miRNA-130b в 4,01 раза относительно нормальной ткани. При этом наблюдается снижение экспрессии данной микроРНК в 2,00 раза в опухолевой ткани у больных группы 2. Соответственно, у больных группы 1 экспрессия miRNA-130b в 8.02 раза выше (p < 0,05) по сравнению с экспрессией у больных группы 2, что может способствовать снижению транскрипционной активности гена RBBP-8 (регулирует пролиферацию клеток) у больных с полным ответом на ЛТ и повышению его экспрессии у больных РПК с плохим ответом на ЛТ (рис. 3).

МикроРНК имеют множество мишеней [14], поэтому для дифференциально экспрессирующихся микроРНК в опухолевых тканях двух групп больных РПК был проведен Over-Representation Analysis (ORA, табл. 5).

Таблица 5

Представленность в сигнальных путях микроРНК с дифференциальной экспрессией

Сигнальный путь/ процесс

P-value

микроРНК

Сигнальный каскад Notch

0,0019

miRNA-6819; miRNA-4728; miRNA-1249; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

RIG-I-подобного рецептора сигнальный путь

0,0025

miRNA-1249; miRNA-6820; miRNA-557; miRNA-6757; miRNA-6737; miRNA-6819; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-130b

Wnt -сигнальный путь

0,0059

miRNA-1249; miRNA-6820; miRNA-557; miRNA-6757; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-6874; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

p53-сигнальный каскад

0,0062

miRNA-1249; miRNA-6820; miRNA-557; miRNA-6757; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-6874; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

IL-17 сигнальный путь

0,0083

miRNA-1249; miRNA-6820; miRNA-557; miRNA-6757; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-130b

Toll-подобного рецептора сигнальный путь

0,0291

miRNA-1249; miRNA-6820; miRNA-557; miRNA-6757; miRNA-6737; miRNA-6819; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-130b

NOD-подобного рецептора сигнальный путь

0,0337

miRNA-6808; miRNA-3202; miRNA-130b ; miRNA-1249; miRNA-6820; miRNA-557; miRNA-6757; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-6874; miRNA-4728

TGF-beta сигнальный путь

0,0354

miRNA-1249; miRNA-6820; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

VEGF сигнальный путь

0,0410

miRNA-1249; miRNA-6820; miRNA-6757; miRNA-6737; miRNA-6819; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-130b

Сигнальные пути сфинголипидов

0,0155

miRNA-1249; miRNA-6820; miRNA-557; miRNA-6757; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Функционирование сплайсосомы

0,0170

miRNA-1249; miRNA-557; miRNA-6757; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-6874; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Сигнальные каскады эпителиальных клеток при инфекции H. pylori

0,0013

miRNA-1249; miRNA-6820; miRNA-557; miRNA-6757; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-4728; miRNA-3202; miRNA-5195; miRNA-130b

Окислительное фосфорилирование

0,0067

miRNA-1249; miRNA-6757; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-6874; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Переваривание и всасывание белков

0,0008

miRNA-1249; miRNA-557; miRNA-6757; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-5195; miRNA-130b

Убиквитин-опосредованный протеолиз

0,0461

miRNA-1249; miRNA-6820; miRNA-557; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-6874; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-130b

Апоптоз

0,0007

miRNA-1249; miRNA-6820; miRNA-557; miRNA-6757; miRNA-1273h; miRNA-6737; miRNA-6819; miRNA-4728; miRNA-6808; miRNA-3202; miRNA-130b

Результаты ORA показывают, что дифференциально экспрессирующиеся в двух группах больных микроРНК, помимо регуляции транскрипционной активности генов BCL-2, CASP-9, BRCA-2, H2AX и RBBP-8 участвуют в контроле над ключевыми для выживания и пролиферации опухолевых клеток сигнальными путями (табл. 5). Таким образом, устойчивость и чувствительность опухолевой ткани прямой кишки, определяющая эффективность лучевой терапии, также связана с дифференциальной экспрессией микроРНК miRNA-6820, miRNA-557, miRNA-6757, miRNA-1249, miRNA-1273h, miRNA-6737, miRNA-6819, miRNA-6874, miRNA-4728, miRNA-6808, miRNA-3202, miRNA-5195-3p и miRNA-130b.

Влияние копийности генов на эффективность ЛТ РПК. Несмотря на то, что нами показана возможность использования показателя транскрипционной активности генов H2AX, BRCA-2, CASP-9, RBBP-8, BCL-2 и ряда микроРНК в оценке эффективности ЛТ РПК следует учитывать, что экспрессия генов и микроРНК является не особо стабильным показателем и способна изменяться в организме пациентов в широком диапазоне под влиянием различных факторов. К тому же матричная РНК во внеклеточной среде быстро разрушается РНКазами [15], что делает невозможным построение подходов малоинвазивной диагностики на её основе. Соответственно, требуется переход на более устойчивый в биологических жидкостях организма молекулярный маркер. CNV (copy number variation, показатель копийности генов) может быть одним из подобных маркеров, не подверженным быстрой деградации в плазме крови. Снижение или повышение числа копий определенного гена, как правило, приводит к изменению уровня экспрессии продукта этого гена – мРНК, протеина или микроРНК [16].

У 20 больных РПК первой группы в опухолевом биопсийном материале наблюдалось двукратное снижение числа копий генов H2AX и RBBP-8 (р < 0,05), а также почти четырехкратное увеличение числа копий гена CASP-9 (р < 0,05) относительно нормальной ткани. У 55 больных второй группы наблюдалось двукратное увеличение числа копий генов BRCA-2 и H2AX, трехкратное увеличение числа копий гена RBBP-8 и четырехкратное увеличение числа копий гена BCL-2 (р < 0.005) относительно условно-нормальной ткани, а также четырехкратное снижение числа копий гена CASP-9 относительно пациентов первой группы (рис. 6).

Между CNV и транскрипционной активностью исследованных генетических локусов обнаружена сильная положительная корреляция: для первой группы среднее значение r = 0,908, для второй группы среднее значение r = 0,847. Также было оценено влияние копийности генов на выживаемость больных РПК.

Рис. 6. Относительная копийность генетических локусов в опухолевой ткани прямой кишки у больных с полным и плохим ответом на лучевую терапию. * – статистически значимые отличия относительно нормальной ткани (р < 0,005), ** – межгрупповые статистически значимые отличия (р < 0,05)

В ходе исследования удалось установить, что на общую выживаемость больных РПК статистически значимо влиял показатель CNV 5 генетических локусов - BRCA-2, RBBP-8, CASP-9, H2AX и BCL-2 (табл. 6).

Таблица 6

Показатель CNV и общая выживаемость больных РПК (однофакторный регрессионного анализа Кокса)

Локус

Β

Отношение шансов

Статистика Wald

Значимость, p

ВRСА-2

3,85

7,1

4,47

0,0115

H2АX

5,79

6,7

5,21

0,0322

САSP-9

-1,99

0,2

6,55

0,0221

ВСL-2

3,15

3,9

6,41

0,0470

RВВP-8

4,88

10,1

3,82

0,0289

Также установлено, что чем выше число копий генов ВRCA-2, H2AX, ВCL-2 и RВВP-8 и ниже число копий гена CASP-9 (р < 0,05) в опухолевой ткани по отношению к нормальной ткани, тем выше риск летального исхода. При этом увеличение числа копий RВВP-8 и уменьшение числа копий гена CASP-9 в опухолевой ткани сопряжено со снижением общей выживаемости больных РПК при наличии нечувствительности к ЛТ (табл. 7).

Таблица 7

Показатель CNV и общая выживаемость больных РПК с учетом чувствительности к ЛТ (регрессионный анализ)

Локус

β

Отношение шансов

Статистика Wald

Значимость, p

ВRСA-2

5,00

5,8

3,95

0,4250

H2АX

7,01

6,1

4,11

0,1042

СASP-9

-2,11

0,1

7,12

0,0079

ВСL-2

3,60

2,9

3,14

0,1197

RВВP-8

4,11

6,1

6,44

0,0390

Методом математического моделирования было предсказано, что общая выживаемость больных РПК в течение 36 месяцев после операции будет снижаться со значения 100 % при достижении в образцах опухоли медианы показателя CNVВRCA-2 величины более 1,9 до 87,5 %, CNVH2AX более 1,4 до 91,1 %, CNVВCL-2 более 3,0 до 94,2 % и CNVRВВP-8 более 2,0 до 65,4 %. Таким образом, число копий генов ВRCA-2, H2AX, ВCL-2, RВВP-8 и СASP9 математически связано с риском развития летального исхода и снижением общей выживаемости больных РПК при плохом ответе на ЛТ.

Следующим этапом работы было тестирование показателя CNV BRCA-2, H2AX, BCL-2, RBBP-8 и CASP-9 во внДНК больных РПК и условно-здоровых доноров. К внДНК относят ядерную и митохондриальную ДНК клеток, подвергшихся процессам апоптоза, ДНК из лимфоцитов и ДНК различных микроорганизмов [16].

У 30 доноров и 75 больных РПК (до ЛТ и колоноскопии) из плазмы крови выделяли внДНК и определяли показатель числа копий генетических локусов ВRCА-2, H2АX, ВCL-2, RВВP-8 и CАSP-9. До ЛТ во внДНК больных РПК группы № 1 обнаружено снижение числа копий генов H2AX и RВВP-8 в 2,03 (р < 0,005) и 1,74 (р < 0,005) раза соответственно относительно группы условно-здоровых доноров. До лучевой терапии во внДНК больных РПК группы № 2 обнаружено увеличение числа копий генов ВRCA-2, H2AX, RВВP-8 и ВCL-2 в 2,25 (р < 0,005) раза, в 2,41 (р < 0,05) раза, в 2,63 (р < 0,05) и 2,17 (р < 0,005) раза соответственно относительно группы условно-здоровых доноров (рис. 7).

Только для двух генетических локусов (H2AX RBBP-8) обнаружено статистически значимое (р < 0,005) пяти- и четырехкратное отличие в числе копий во внДНК плазмы крови у больных РПК с полным ответом от больных РПК с плохим ответом на ЛТ. Соответственно, показатели копийности генов H2АX и RВВP-8 во внДНК больных РПК обладают наибольшим потенциалом в качестве молекулярных маркеров для определения степени ответа на лучевую терапию.

Рис. 7. CNV во внДНК у больных РПК относительно CNV во внДНК условно-здоровых доноров. * – статистически значимые отличия (р < 0,05) относительно условно-здоровых доноров, ** – статистически значимые отличия (р < 0.005) от группы № 1

Также опираясь на данные корреляционного анализа (средняя величина r для копийности во внДНК и экспрессии в тканях исследуемых генов была выше 0,752), можно сделать вывод, что у больных РПК во внДНК показатель CNV генов, регулирующих репарацию ДНК и пролиферацию (BRCA-2, H2AX, BCL-2, RBBP-8) отражает уровень их CNV в тканях опухоли, где CNV, в свою очередь, регулирует уровень транскрипционной активности этих генов и в целом обеспечивает молекулярную основу чувствительности/резистентности к ЛТ.

Заключение

Таким образом, проведенный нами комплексный скрининг генетических и эпигенетических предикторов эффективности лучевой терапии опухолей прямой кишки позволил установить, что эффективность ЛТ РПК зависит от уровня экспрессии 13 микроРНК (miRNA-3202, miRNA-5195, miRNA-130b, miRNA-1249, miRNA-4728, miRNA-6820, miRNA-6757, miRNA-1273h, miRNA-6737, miRNA-6819, miRNA-557, miRNA-6874, miRNA-6808,), обеспечивающих эффективную регуляцию системы репарации ДНК (BRCA-2, H2AX и RBBP-8) и апоптоза (CASP-9 и BCL-2). В свою очередь, экспрессия генов, таргетируемых этими микроРНК, также может выступать в роли маркера чувствительности к ЛТ. Подтвержденная в ходе исследования взаимосвязь между экспрессией и копийностью генов позволяет использовать показатель копийности генов BCL-2, CASP-9, BRCA-2, H2AX и RBBP-8, также в качестве предиктора эффективности ЛТ во образцах биопсии, а показатель копийности генов H2AX и RBBP-8 в качестве маркера эффективности ЛТ во внДНК больных РПК.

Исследование выполнено в рамках госзадания «Поиск предикторов радиорезистентности рака прямой кишки и разработка персонифицированных неоадъювантных терапевтических подходов».


Библиографическая ссылка

Кутилин Д.С., Гусарева М.А., Кошелева Н.Г., Павлятенко И.В., Савченко Д.А., Габричидзе П.Н., Гварамия А.К., Шляхова О.В., Бабенков О.Ю. ГЕНЕТИЧЕСКИЕ И ЭПИГЕНЕТИЧЕСКИЕ ПРЕДИКТОРЫ ЭФФЕКТИВНОСТИ ЛУЧЕВОЙ ТЕРАПИИ ОПУХОЛЕЙ ПРЯМОЙ КИШКИ // Современные проблемы науки и образования. – 2021. – № 4. ;
URL: https://science-education.ru/ru/article/view?id=30963 (дата обращения: 24.10.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074