Электронный научный журнал
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,931

КОПИЙНОСТЬ ГЕНОВ КАК ФАКТОР УСТОЙЧИВОСТИ ОПУХОЛЕВЫХ КЛЕТОК ПРЕДСТАТЕЛЬНОЙ ЖЕЛЕЗЫ К ОБЛУЧЕНИЮ

Кутилин Д.С. 1 Зинькович М.С. 1 Гусарева М.А. 1 Фаенсон А.В. 1 Карнаухова Е.А. 1 Розенко Л.Я. 1 Фатькина Н.Б. 1 Удаленкова И.А. 1 Васильева Е.О. 1 Гаппоева М.А. 1
1 ФГБУ "Национальный медицинский исследовательский центр онкологии" Министерства здравоохранения Российской Федерации
Лучевая терапия играет ведущую роль в лечении рака предстательной железы, однако появление радиорезистентных форм этого заболевания диктует необходимость персонифицированного подхода, основанного на данных молекулярных маркеров. К подобным маркерам относится показатель изменчивости копийности генов (Copy Number Variation (CNV)). Целью исследования стала валидация в условиях модельного эксперимента потенциальных предикторов радиорезистентности клеток предстательной железы (показатель копийности генов), выбранных на основании данных метаанализа. В исследовании использовалась культура клеток рака предстательной железы PC-3. Определение относительной копийности 32 генов (BRCA1, BRCA2, AKT, ATM, BRIP, H2AX, EXO1, CDK1, XRCC4, RAD50, RAP80, RIF1, RNF168, TOPB1, KU70, CDKN1B, CCND1, CCND3, FGFR2, HIST1, RBBP8, EP300, LIG4, C-FLIP, PTEN, TP53, BAX, CASP8, CASP3, CASP9, MDM2, BCL2) проводили методом Real-Time qPCR. В клетках PC-3 сохранившихся после облучения в дозе 6 Гр была повышена копийность CDK1, CDKN1B, H2AX, PTEN, XRCC4 и RBBP8 и снижена копийность генов BCL2, CCND3, TP53 и BAX относительно клеток контрольной группы. В клетках PC-3, сохранившихся после облучения в дозе 7 Гр, была повышена копийность CDK1, CDKN1B, PTEN, XRCC4, EP300 и RBBP8 и снижена копийность генов CCND3, TP53 и BCL2 относительно клеток контрольной группы. Таким образом, исследование позволило установить, что сохранившие жизнеспособность после пятидневной лучевой терапии клетки линии PC-3 обладают особыми характеристиками, обеспечивающими их выживание: повышенной копийностью генов CDK1, CDKN1B, H2AX, PTEN, XRCC4, RBBP8 и EP300 и сниженной копийностью CCND3, BAX, TP53 и BCL2.
рак предстательной железы
лучевая терапия
культура клеток
копийность генов
апоптоз
репарация днк
1. Зинькович М.С., Максимов А.Ю., Розенко Л.Я., Гусарева М.А., Карнаухова Е.А., Фаенсон А.В., Тимошкина Н.Н., Кутилин Д.С. Радиорезистентность как фактор эволюции лучевой терапии рака предстательной железы // Современные проблемы науки и образования. 2019. № 2. URL: http://science-education.ru/ru/article/view?id=28627 (дата обращения: 24.04.2020)
2. Chaiswing L., Weiss H.L., Jayswal R.D. Profiles of Radioresistance Mechanisms in Prostate Cancer. Crit. Rev. Oncog. 2018. Vol. 23(1–2). P. 39–67
3. Mottet N., Bellmunt J., Bolla M. EAU-ESTRO-SIOG Guidelines on Prostate Cancer. Part 1: Screening, Diagnosis, and Local Treatment with Curative Intent. Eur. Urol. 2017. V. 71. P. 618–629.
4. Negre-Salvayre A., Coatrieux C., Ingueneau C., Salvayre R. Advanced lipid peroxidation end products in oxidative damage to proteins. Potential role in diseases and therapeutic prospects for the inhibitors. Br. J. Pharmacol. 2008. Vol.153. P. 6–20.
5. Li Z., Pearlman A.H., Hsieh P. DNA mismatch repair and the DNA damage response. DNA Repair. (Amst). 2016. Vol. 38. P. 94–101.
6. Sonveaux P. ROS and radiotherapy: More we care. Oncotarget. 2017. Vol. 8 (22). P. 35482-3.
7. Кутилин Д.С., Сагакянц А.Б., Зинькович М.С., Максимов А.Ю., Гусарева М.А., Бондаренко Е.С., Потемкин Д.С., Васильченко Н.Г. Влияние различных доз лучевой терапии на выживаемость опухолевых клеток предстательной железы линии PC-3 // Современные проблемы науки и образования. 2019. № 2. URL: http://www.science-education.ru/article/view?id=28740 (дата обращения: 18.04.2020).
8. Кутилин Д.С., Айрапетова Т.Г., Анистратов П.А., Пыльцин С.П., Лейман И.А., Карнаухов Н.С., Кит О.И. Изменение копийности генов в опухолевых клетках и внеклеточной ДНК у больных аденокарциномой лёгкого // Бюллетень экспериментальной биологии и медицины. 2019. Т. 167 (6). С. 731–738.
9. Krishnan A., Zhang R., Yao V., Theesfeld C.L., Wong A.K., Tadych A., Volfovsky N., Packer A., Lash A., Troyanskaya O.G. Genome-wide prediction and functional characterization of the genetic basis of autism spectrum disorder. Nature Neuroscience. 2016. Vol. 19(11). P.1454-1462
10. Wu G., Feng X., Stein L. A human functional protein interaction network and its application to cancer data analysis. Genome Biol. 2010. Vol.11(5). P. 53.

Злокачественные опухоли предстательной железы занимают 2-е место в структуре онкологической заболеваемости в России у мужчин всех возрастных групп. Причем в последнее десятилетие отмечают значительный рост заболеваемости, который составляет 143% и является самым высоким показателем среди опухолей других нозологий. [1].

Основными терапевтическими подходами при данной патологии являются радикальная простатэктомия и лучевая терапия (ЛТ) [2]. Последняя играет одну из ведущих ролей в лечении рака предстательной железы (РПЖ) [3], однако появление радиорезистентных форм диктует необходимость персонифицированного подхода, основанного на данных молекулярно-генетических маркеров [1].

Причины радиорезистентности активно изучаются. Одной из них может быть гиперактивация в опухолевых клетках таких механизмов, как репарация ДНК [4]. Как известно, баланс между повреждением и репарацией ДНК определяет выживаемость клеток после воздействия ионизирующего излучения [5]. Не менее важным фактором, оказывающим влияние на чувствительность опухолевых клеток к излучению, является гипоксия, с учетом роли кислорода в реакции образования активных форм кислорода (АФК), индуцированной облучением [6].

Несмотря на эволюцию методов лучевой терапии злокачественных опухолей предстательной железы и на то, что известны многие механизмы формирования радиорезистентности опухолей разных нозологий, в настоящее время отсутствует возможность достоверного определения чувствительности РПЖ к лучевой терапии. Поэтому проблема прогнозирования радиорезистентности остается актуальной. Для ее решения необходимы модельные эксперименты на клеточных культурах опухолевых клеток с оценкой влияния ЛТ на их выживаемость [7].

Выявление молекулярных маркеров радиорезистентности с последующим дифференцированным подходом к выбору тактики лечения может существенно повлиять на результаты терапии больных РПЖ в сторону их улучшения [1]. К подобным маркерам относится показатель копийности генов (Copy Number Variation (CNV)) – генетический полиморфизм, приводящий к снижению или повышению числа копий определенного гена и, как следствие, к снижению или повышению уровня молекулярного продукта гена – мРНК, не кодирующей РНК или белка [8].

Метаанализ (на основании данных, опубликованных с 2000 по 2020 г.) обобщил результаты лучевой терапии больных локализованным раком предстательной железы и показатели по изменчивости копийности генов, и позволил сформировать перечень потенциальных молекулярных маркеров, состоящий из 32 генетических локусов – компонентов сигнальных путей, регулирующих репарацию ДНК, клеточный цикл и апоптоз.

Поэтому целью исследования стала валидация в условиях модельного эксперимента потенциальных предикторов радиорезистентности клеток предстательной железы (показатель копийности генов), выбранных на основании данных метаанализа.

Материалы и методы исследования

В исследовании использовалась культура клеток человека – рака предстательной железы PC-3. Культивирование клеточной массы проводилось в стандартных условиях, описанных нами в предыдущих работах (стерильные плоскодонные флаконы, среда RPMI-1640 c 10% фетальной телячьей сывороткой, гентамицин 50 мкг/мл, 5% CO2, 95% влажности и 37 0C) [7].

Для модельного эксперимента использовали дозы 6 и 7 Гр (облучение проводили 5 раз через каждые 24 ч на линейном ускорителе Novalis TX). Подсчет клеток проводили в камере Горяева (0,4% раствор трипанового синего). На 5-й день облучения клетки PC-3 снимали с подложки раствором Трипсин/Версена. Количество клеток, находящихся на различных стадиях апоптоза, оценивали на проточном цитофлюориметре Facs Canto II с использованием Annexin V-FITC Apoptosis Detection Kit [7].

Из клеток фенол-хлороформным методом проводилась экстракция ДНК. Для определения относительной копийности генов нами, с использованием базы данных NCBI GenBank, были разработаны последовательности 32 пар синтетических олигонуклеотидов (BRCA1, BRCA2, AKT, ATM, BRIP, H2AX, EXO1, CDK1, XRCC4, RAD50, RAP80, RIF1, RNF168, TOPB1, KU70, CDKN1B, CCND1, CCND3, FGFR2, HIST1, RBBP8, EP300, LIG4, C-FLIP, PTEN, TP53, BAX, CASP8, CASP3, CASP9, MDM2, BCL2) и 3 пары для референсных локусов (ACTB, B2M, GAPDH) (табл. 1). Определение относительной копийности генетических локусов проводили методом Real-Time qPCR (RT-qPCR).

Таблица 1

Последовательности праймеров для определения копийности генов

Праймер

Последовательность праймера

Праймер

Последовательность праймера

1

AKT1_F

ATGGACAGGGAGAGCAAACG

AKT1_R

TGATGCACCAGCTGACAGG

2

ATM_F

GCAAAACCAAATGTATCAGCCTCA

ATM_R

GACCAAACTACTGATTTCCTGCAT

3

BRIP1_F

GAAGAACTTGTCAGCCTGGGG

BRIP1_R

TCTTGTATTAGTTCTCGGGCTGTG

4

BRCA1_F

GTAGCCCCTTGGTTTCCGTG

BRCA1_R

CCCTTTCCCGGGACTCTACT

5

BRCA2_F

TGCATCCCTGTGTAAGTGCAT

BRCA2_R

ACGTACTGGGTTTTTAGCAAGC

6

CDK1_F

CAGGGGATTGTGTTTTGTCACT

CDK1_R

ACCACTATTCCACTTGCCTCAT

7

CDKN1B_F

TCGGGGTCTGTGTCTTTTGG

CDKN1B_R

CTCCCGTTAGACACTCGCAC

8

CCND1_F

GGTGAACAAGCTCAAGTGGAAC

CCND1_R

CCGGCCAGGGTCACCTAA

9

CCND3_F

TTCCACGGTTGCTACATCGT

CCND3_R

ACACAGCAGCTCCATACTCG

10

EXO1_F

GTTACCCGTGTTCTGCGTTG

EXO1_R

GAACCCACCCATTAGCCTCC

11

FGFR2_F

CAAGGACCACTCTTCTGCGT

FGFR2_R

CTTGAATGGCAACGCTCCTC

12

HIST1H2_F

CGTGCTACTGCCCAAGAAGA

HIST1H2_R

AGCCTTTGGTTCCTTTGGGAT

13

H2AX_F

AGGCCTCCCAGGAGTACTAA

H2AX_R

CTGAAGCGGCTCAGCTCTTT

14

KU70_F

AAGATCATAAGCAGTGATCGAGA

KU70_R

TCCAGCTCCTGTAAGACGTA

15

PTEN _F

GTCCAGAGCCATTTCCATCCT

PTEN _R

TGTCATGTCTGGGAGCCTGT

16

RAD50 _F

TGGCTGGCAGGATCTTTTGG

RAD50 _R

GCTTAACTGAGGCCGAAGCA

17

RAP80_F

CAGATGTACTGGCCACTCGG

RAP80_R

CAGTGCCTAGATGTGTCCCC

18

RB1_F

TCCGGTTTTTCTCAGGGGAC

RB1_R

CAGCGAGCTGTGGAGGAG

19

Rif1_F

GGCTGTTTCCATCGGTCACT

Rif1_R

TCCAAAGTCTCCAACAGCGG

20

RNF168_F

TGAGGGGAGGAGAGGACTTG

RNF168_R

AGGCAAACAGGAATACCCCG

21

TGFB1 _F

TTGAGACTTTTCCGTTGCCG

TGFB1 _R

GAGGGCTGGTCCGGAATG

22

TopBP1 _F

TGGGCGGACGAGTATACAGA

TopBP1 _R

AGGTTTCTTCAGGTTTGCAGC

23

TP53 _F

GGTCGGTGGGTTGGTAGTTT

TP53 _R

GTGTGGGATGGGGTGAGATT

24

XRCC4 _F

CAGACTTGGTTCCTTCAACCT

XRCC4 _R

TCTGCAGGTGCTCATTTTTGG

25

BAX_F

GCCTCCTCTCCTACTTTGGG

BAX_R

AAACACAGTCCAAGGCAGC

26

CASP8_F

TCTTTATGATATTGGGGAACAACTG

CASP8_R

GTTCTTGCTTCCTTTGCGGA

27

CASP3_F

ATGCAGCAAACCTCAGGGAA

CASP3_R

TTCACCATGGCTCAGAAGCA

28

CASP9_F

CTCCACTTCCCCTGAAGACG

CASP9_R

CTGGGTGTGGGCAAACTAGA

29

MDM2_F

TCTTTGGGACCCATCTACCCT

MDM2_R

AGAATGCTTTAGTCCACCTAACCTT

30

BCL2_F

GAGTGGGATGCGGGAGATG

BCL2_R

GGTGAAGGGCGTCAGGTG

31

RBBP8 _F

ACCGAGGATTTGGCACTCTG

RBBP8 _R

TCCGAGATTGCCTCGGGATT

32

EP300_F

TCGGCGAATTTGTGCTCTTG

EP300_R

CCTTTTTCTCTTCGCCGGGT

33

LIG4 _F

GGGTAAAGGATCACGGGGTG

LIG4 _R

CCAGACCCAACACGAGAGAG

34

C-FLIP_F

GGCTCCCAGAGTGTGTATGG

C-FLIP_R

GGCCCTCTGACACCACATAG

35

GAPDH_F

GCTGAACGGGAAGCTCACT

GAPDH_R

GCAGGTTTTTCTAGACGGCAG

36

ACTB_F

CACCCTGAAGTACCCCATCG

ACTB_R

TGTAGAAGGTGTGGTGCCAG

37

B2M_F

TGAGTGCTGTCTCCATGTTTGA

B2M_R

ATTCTCTGCTCCCCACCTCT

Примечание. F – прямой праймер, R – обратный праймер

RT-qPCR амплификация проводилась на термоциклере Bio-Rad CFX96 (Bio-Rad, США), с использованием реакционной смеси, состоящей из однократного ПЦР-буфера, смеси 0,2 мМ dNTP, 2,0 мМ MgCl2, праймеров в концентрации 500 нМ, 0,1 ед. акт./мкл Taq-полимераза (Синтол, Россия) и 12 нг ДНК. В качестве красителя использовали EvaGreen Dye (Biotium, США). Амплификация каждого образца осуществлялась в трех технических повторах. Далее усредненные данные порогового цикла по каждому генетическому локусу нормировались по усредненному показателю порогового цикла для референсных генов (ΔCt=среднее Ct(исследуемого гена) – среднее геометрическое Ct(референсных генов)), и вычислялась величина rQ, равная 2-ΔCt. Далее вычисляли среднее rQоблученных клеток и среднее rQинтактных клеток (контроль) для каждого генетического локуса и соотношение RQоб/RQк, собственно и представляющее собой показатель относительной копийности генов в облученных образцах по отношению к контрольным [7].

Для статистической обработки данных применяли однофакторный дисперсионный анализ (One-Way ANOVA). Иерархический кластерный анализ и построение тепловых карт осуществляли в среде R (R-Studio 8.10.173.987), используя собственные скрипты. Алгоритм сравнения большего числа множеств (реализованн на JavaScript) использовался для построения диаграмм Эдвардса – Венна. Алгоритм FMD (Functional module detection) был применен для кластеризации генов по выполняемой ими функции, при этом Q-value каждого члена функционального модуля рассчитывалось с применением одностороннего точного критерия Фишера и поправки Бенджамини – Хохберга для корректировки множественного сравнения [9].

Результаты исследования и их обсуждение

В результате 5-дневного эксперимента по облучению в дозах 6 и 7 Гр клеток PC-3 на линейном ускорителе Novalis TX (Varian, США) около 50% от оставшихся опухолевых клеток (15% от изначального количества) сохранили свою жизнеспособность. Нами был проведен анализ дифференциальной копийности 32 генов в интактных (контрольных) и облученных клетках (рис. 1).

Рис. 1. Heatmap и кластерный анализ дифференциальной копийности 32 генов в интактных и облученных клетках PC-3

По особенностям уровня копийности в интактных и облученных образцах было выделено 4 основных кластера генов: 1 – (BRCA1, BRCA2, BRIP, RNF168, C-FLIP, EXO1, LIG4), 2 – (ATM, CDKN1B, HIST1, CASP8, TP53, RIF1, BAX), 3 – (AKT, CCND3, H2AX, CCND1, RAD50, FGFR2, RBBP8, EP300, RAP80, BCL2), 4 – (PTEN, KU70, TOPB1, MDM2, XRCC4, CASP3).

Таблица 2

Сходства и различия в показателе копийности генов между кластерами

Ген

Кол-во сравниваемых групп, в которых повышен уровень копийности гена

Копийность гена повышена в группах

ATM

9

C1, C2, C3, 6Y1, 6Y2, 6Y3, 7Y1, 7Y2, 7Y3

BRIP

6

6Y1, 6Y2, 6Y3, 7Y1, 7Y2, 7Y3

CDK1

6

6Y1, 6Y2, 6Y3, 7Y1, 7Y2, 7Y3

MDM2

6

C1, C2, C3, 6Y1, 7Y2, 7Y3

PTEN

6

6Y1, 6Y2, 6Y3, 7Y1, 7Y2, 7Y3

RBBP8

6

6Y1, 6Y2, 6Y3, 7Y1, 7Y2, 7Y3

TOPB1

6

6Y1, 6Y2, 6Y3, 7Y1, 7Y2, 7Y3

XRCC4

6

6Y1, 6Y2, 6Y3, 7Y1, 7Y2, 7Y3

BRCA2

5

C1, 6Y2, 6Y3, 7Y1, 7Y3

CCND1

5

C1, C2, 6Y1, 7Y1, 7Y3

CDKN1B

5

6Y2, 6Y3, 7Y1, 7Y2, 7Y3

FGFR1

5

6Y1, 6Y2, 6Y3, 7Y1, 7Y2

KU70

5

C1, C2, 6Y1, 6Y3, 7Y1

RNF168

5

C1, C2, C3, 6Y1, 6Y2

CASP3

4

C1, 6Y1, 6Y2, 7Y3

CASP8

4

C1, C2, 6Y2, 7Y3

RAD50

4

C1, C2, 6Y1, 6Y2

BAX

3

C1, C2, C3

C-FLIP

3

C1, C2, 6Y1

CASP9

3

C1, C2, C3

EXO1

3

6Y1, 6Y2, 7Y3

RAP80

3

C1, C2, 7Y1

RIF1

3

6Y1, 6Y2, 7Y3

TP53

3

C1, C2, C3

AKT

2

6Y3, 7Y1

BCL2

2

C1, C2

BRCA1

2

C1, C2

HIST1

2

6Y2, 7Y2

LIG4

2

6Y1, 7Y2

Условные обозначения (здесь и на рис. 1 и 2): C – контроль, 6Y – доза 6 Гр; 7Y – доза 7 Гр

Также интактные и облученные клетки по схожести показателя копийности генов были объединены в кластеры (рис. 1). Вероятно, изначальное присутствие в клеточной линии PC-3 клонов, с определенным уровнем копийности рассматриваемых генов, и обеспечило выживание субпопуляции этих клеток, а также отразилось на формировании кластеров, объединяющих интактные и облученные клетки по сходству копийности некоторых генов, представленных на рис. 2 и в табл. 2.

Рис. 2. Диаграмма Эдвардса – Венна (показано сходство по количеству генов с повышенной копийностью в 9 группах – 3 контрольных, 3 облученных в дозе 6 Гр и 3 в дозе 7 Гр)

На рис. 3 представлены данные, полученные после нормализации показателей копийности генов в облученных клетках относительно интактных. В клетках PC-3, подвергнутых облучению 6 Гр, статистически значимо была повышена копийность генов CDK1, CDKN1B, H2AX, PTEN, XRCC4 RBBP8 в 1,9; 2,5; 1,9; 1,7; 1,5 и 2,0 раза соответственно (р<0,05), и снижена копийность генов BCL2, CCND3, TP53 и BAX в 2,6; 2,4; 1,9 и 1,8 раза соответственно (р<0,05) относительно клеток контрольной группы.

Рис. 3. Относительная копийность генов в клетках PC-3 устойчивых к облучению в дозе 6 Гр в течение 5 дней. * – статистически значимые отличия показателя копийности генов в облученных клетках относительно интактных (р<0,05, тест Newman-Keuls)

В клетках PC-3, подвергнутых облучению 7 Гр, статистически значимо была повышена копийность генов – CDK1, CDKN1B, PTEN, XRCC4, EP300 и RBBP8 в 1,8; 2,6; 1,7; 1,7; 2,0 и 1,7 раза соответственно (р<0,05), при этом была снижена копийность генов CCND3, TP53 и BCL2 в 2,6; 1,8 и 2,4 раза соответственно (р<0,05) относительно клеток контрольной группы (рис. 4).

Рис. 4. Относительная копийность генов в клетках PC-3 устойчивых к облучению в дозе 7 Гр в течение 5 дней. * – статистически значимые отличия показателя копийности генов в облученных клетках относительно интактных (р<0,05, тест Newman-Keuls)

Очевидно на выживаемость клеточных субпопуляций линии PC-3 в условиях облучения копийностью генов AKT, ATM, BRIP, BRCA1, BRCA2, H2AX, RAD50, RAP80, RIF1, RNF168, TOPB1, CASP8, CASP3, CASP9, MDM2, LIG4 и C-FLIP влияние не оказывает (копийность этих генов не отличается в группах – контроль, доза 6 Гр и 7 Гр).

Анализ сигнальных путей, в которых задействованы гены BRCA1, BRCA2, AKT, ATM, BRIP, H2AX, EXO1, CDK1, XRCC4, RAD50, RAP80, RIF1, RNF168, TOPB1, KU70, CDKN1B, CCND1, CCND3, FGFR2, HIST1, RBBP8, EP300, LIG4, C-FLIP, PTEN, TP53, BAX, CASP8, CASP3, CASP9, MDM2 и BCL2 с помощью алгоритма FMD позволил выделить 6 функциональных модулей, которые визуально представлены на рис. 5.

Рис. 5. Функциональная классификация потенциальных предикторов чувствительности опухолевых клеток предстательной железы к ЛТ

Также проведен анализ сети взаимодействия и индекса взаимосвязи генов, изменяющих свою копийность – CDK1, CDKN1B, H2AX, PTEN, XRCC4, BCL2, CCND3, TP53, BAX и RBBP8 (рис. 6). Данные гены являются компонентами различных сигнальных путей нормальных и опухолевых клеток предстательной железы, и изменение показателя их копийности приводит к изменению транскрипционной активности целого ряда других генов [10].

Итак, измененная в определенной субпопуляции клеток копийность генов CDK1, CDKN1B, H2AX, PTEN, XRCC4, BCL2, EP300, CCND3, TP53, BAX и RBBP8, вероятно, обеспечивает повышенную выживаемость опухолевых клеток предстательной железы в условиях лучевой терапии, за счет изменения работы ключевых сигнальных путей обеспечивающих репарацию ДНК, регуляцию апоптоза и клеточного цикла.

Рис. 6. Сеть взаимодействия и индекс взаимосвязи генов в клетках простаты (слева) и в клетках простаты в условия воздействия ионизирующего излучения (справа). Сеть функциональных взаимодействий указанных выше генов предсказана путем объединения данных полногеномных экспериментов. Узлы представляют гены, а ребра представляют предсказанную вероятность того, что связанные гены участвуют в одном и том же биологическом процессе

Заключение

Таким образом, проведенное исследование позволило установить, что сохранившие после пятидневной лучевой терапии при 6 и 7 Гр жизнеспособность клетки линии PC-3 обладают особыми генетическими характеристиками, собственно, и обеспечивающими их выживание: повышенной копийностью генов CDK1, CDKN1B, H2AX, PTEN, XRCC4, RBBP8 и EP300 и сниженной копийностью CCND3, BAX, TP53 и BCL2. Данные генетические локусы можно рассматривать как наиболее значимые молекулярные предикторы радиорезистентности клеток предстательной железы и можно рекомендовать определение показателя их копийности к апробации в клинической практике.

Исследование выполнено в рамках госзадания «Поиск молекулярно-генетических предикторов радиорезистентного рака предстательной железы и разработка персонифицированных терапевтических подходов».


Библиографическая ссылка

Кутилин Д.С., Зинькович М.С., Гусарева М.А., Фаенсон А.В., Карнаухова Е.А., Розенко Л.Я., Фатькина Н.Б., Удаленкова И.А., Васильева Е.О., Гаппоева М.А. КОПИЙНОСТЬ ГЕНОВ КАК ФАКТОР УСТОЙЧИВОСТИ ОПУХОЛЕВЫХ КЛЕТОК ПРЕДСТАТЕЛЬНОЙ ЖЕЛЕЗЫ К ОБЛУЧЕНИЮ // Современные проблемы науки и образования. – 2020. – № 4.;
URL: http://science-education.ru/ru/article/view?id=29866 (дата обращения: 13.05.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074