Сетевое издание
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

ИССЛЕДОВАНИЕ ГЕНЕТИЧЕСКИХ ПОЛИМОРФИЗМОВ, АССОЦИИРОВАННЫХ С РАЗВИТИЕМ АНТРАЦИКЛИН-ОПОСРЕДОВАННОЙ КАРДИОТОКСИЧНОСТИ, У ПАЦИЕНТОК С ОНКОПАТОЛОГИЕЙ МОЛОЧНОЙ ЖЕЛЕЗЫ

Гвалдин Д.Ю. 1 Омельчук Е.П. 1 Новикова И.А. 1 Ратиева А.С. 1 Ващенко Л.Н. 1 Тимошкина Н.Н. 1 Владимирова Л.Ю. 1
1 ФГБУ "РНИОИ" Минздрава России
В настоящем исследовании методами HRM-PCR и секвенирования ДНК по Сэнгеру было проведено генотипирование 80-ти пациенток с диагнозом рак молочной железы (РМЖ) на наличие четырех маркеров (rs8187710 ABCC2, rs11549465 HIF1A, rs1333049 CDKN2A/B и rs28714259), для которых описан повышенный риск развития как сердечно-сосудистой патологии, так и осложнений вследствие назначения антрациклиновых препаратов, широко применяемых в терапии онкологических заболеваний. Аллельная частота составила 0,070 для rs8187710, 0,075 для rs11549465, 0,350 для rs1333049, что в последнем случае достоверно ниже значения для других европейских популяций (р=0,007). Впервые определена частота rs28714259 (0,090) - однонуклеотидного полиморфизма (A>G) в некодирующей области 15 хромосомы. Выявленное в выборке пациенток с онкопатологией молочной железы распределение частот генетических полиморфизмов и генотипов по rs8187710 ABCC2, rs11549465 HIF1A соответствует показателям европейской популяции, и статистически достоверно реже встречается аллель rs1333049 CDKN2A/B. Идентифицированный случай антрациклин-опосредованной кардиопатии (АОК) с характерным сочетанием трех полиморфных локусов дает возможность предположить о многофакторном генезе АОК и определяет перспективность дальнейших исследований выбранных полиморфизмов.
антрациклин-опосредованная кардиотоксичность
полиморфизмы
abcc2
hif1a
cdkn2a/b
1. Селиверстова Д.В., Евсина О.В. Кардиотоксичность химиотерапии // Сердце: журнал для практикующих врачей 2016. №. 15 (1). С. 50-57. DOI: 10.18087/rhj.2016.1.2115.
2. Shikhlyarova A.I., Vladimirova L.Y., Tikhanovskaya N.М., Arapova Y.Y., Dashkova I.R., Babieva S.M. The prospects for applications of cardiometric approach in evaluation of cardiotoxicity under Anthracyclines therapy in patients with breast cancer. Cardiometry. 2018. P. 15-21. DOI: 10.12710/cardiometry.2018.13.1521.
3. Mobaraki M., Faraji A., Zare M., Dolati P., Ataei M., Dehghan Manshadi H.R. Molecular Mechanisms of Cardiotoxicity: A Review on the Major Side-effect of Doxorubicin. Indian J Pharm Sci. 2017. Vol. 79 (3). P. 335-344. DOI: 10.4172/pharmaceutical-sciences.1000235.
4. dos Santos D.S., dos Santos Goldenberg R.C. Doxorubicin-Induced Cardiotoxicity: From Mechanisms to Development of Efficient Therapy. Cardiotoxicity. 2018. P. 4-24. DOI: 10.5772/intechopen.79588.
5. Armenian S.H., Ding Y., Mills G., Sun C., Venkataraman K., Wong F.L. Neuhausen S.L., Senitzer D., Wang S., Forman S.J., Bhatia S. Genetic susceptibility to anthracycline-related congestive heart failure in survivors of haematopoietic cell transplantation. Br J Haematol. 2013. Vol. 163 (2). P. 205-213. DOI: 10.1111/bjh.12516.
6. Schneider B.P., Shen F., Gardner L., Radovich M., Li L., Miller K.D., Jiang G., Lai D., O'Neill A., Sparano J.A., Davidson N.E., Cameron D., Gradus-Pizlo I., Mastouri R.A., Suter T.M., Foroud T., Sledge G.W.Jr. Genome-Wide Association Study for Anthracycline-Induced Congestive Heart Failure. Clin Cancer Res. 2017. Vol. 23 (1). P. 43-51. DOI: 10.1158/1078-0432.CCR-16-0908.
7. Knowles D.A., Burrows C.K., Blischak J.D., Patterson K.M., Serie D.J., Norton N., Ober C., Pritchard J.K., Gilad Y. Determining the genetic basis of anthracycline-cardiotoxicity by molecular response QTL mapping in induced cardiomyocytes. eLife. 2017. Vol. 7. e33480. DOI: 10.7554/eLife.33480.
8. Linschoten M., Teske A.J., Cramer M.J., van der Wall E., Asselbergs F.W. Chemotherapy-Related Cardiac Dysfunction: A Systematic Review of Genetic Variants Modulating Individual Risk. Circ Genom Precis Med 2018. Vol. 11 (1). e001753. DOI: 10.1161/CIRCGEN.117.001753.
9. Wojnowski L., Kulle B., Schirmer M., Schlüter G., Schmidt A., Rosenberger A., Vonhof S., Bickeböller H., Toliat M.R., Suk E.K., Tzvetkov M., Kruger A., Seifert S., Kloess M., Hahn H., Loeffler M., Nürnberg P., Pfreundschuh M., Trümper L., Brockmöller J., Hasenfuss G. NAD(P)H oxidase and multidrug resistance protein genetic polymorphisms are associated with doxorubicin-induced cardiotoxicity. Circulation. 2005. Vol. 112 (24). P. 3754-3762. DOI: 10.1161/CIRCULATIONAHA.105.576850.
10. Brown D.I., Willis M.S., Berthiaume J.M. Chapter 11 - Influence of Ischemia-Reperfusion Injury on Cardiac Metabolism. The Scientist's Guide to Cardiac Metabolism. Academic Press. 2016. P. 155-167. DOI: 10.1016/B978-0-12-802394-5.00011-X.
11. Strauss E., Waliszewski K., Oszkinis G., Staniszewski R. Polymorphisms of genes involved in the hypoxia signaling pathway and the development of abdominal aortic aneurysms or large-artery atherosclerosis. J Vasc Surg. 2015. Vol. 61 (5). P. 1105-1113. DOI: 10.1016/j.jvs.2014.02.007.
12. Huang L., Li M.Q., Ou C., Huang W.C., Liu J.F., Huang H. Association of hypoxia-inducible factor-1 alpha gene polymorphism with renal cell carcinoma susceptibility. J Can Res Ther. 2018. Vol. 14. P. 1105-1109. DOI: 10.4103/0973-1482.199456.
13. Gladek I., Ferdin J., Horvat S., Calin G.A., Kunej T. HIF1A gene polymorphisms and human diseases: graphical review of 97 association studies. Genes Chromosomes Cancer 2017. Vol. 56 (6). P. 439-452. DOI: 10.1002/gcc.22449.
14. Ivanova A.A., Maksimov V.N., Orlov P.S., Ivanoshchuk D.E., Savchenko S.V., Voevoda M.I. Association of the genetic markers for myocardial infarction with sudden cardiac death. Indian Heart J. 2017. Vol. 69. Suppl 1. S8-S11. DOI: 10.1016/j.ihj.2016.07.016.
15. Patel R.S., Schmidt A.F., Tragante V., McCubrey R.O., Holmes M.V., Howe L.J., Direk K., Åkerblom A., Leander K., Virani S.S., Kaminski K.A., Muehlschlegel J.D., Dubé M.P., Allayee H., Almgren P., Alver M., Baranova E.V., Behlouli H., Boeckx B., Braund P.S., Breitling L.P., Delgado G., Duarte N.E., Dufresne L., Eriksson N, Foco L, Gijsberts C.M., Gong Y., Hartiala J., Heydarpour M., Hubacek J.A., Kleber M., Kofink D., Kuukasjärvi P., Lee V.V., Leiherer A., Lenzini P.A., Levin D., Lyytikäinen L.P., Martinelli N., Mons U., Nelson C.P., Nikus K., Pilbrow A.P., Ploski R., Sun Y.V., Tanck M.W.T., Tang W.H.W., Trompet S., van der Laan S.W., Van Setten J., Vilmundarson R.O., Viviani Anselmi C., Vlachopoulou E., Boerwinkle E., Briguori C., Carlquist J.F., Carruthers K.F., Casu G., Deanfield J., Deloukas P., Dudbridge F., Fitzpatrick N., Gigante B., James S., Lokki M.L., Lotufo P.A., Marziliano N., Mordi I.R., Muhlestein J.B., Newton-Cheh C., Pitha J., Saely C.H., Samman-Tahhan A., Sandesara P.B., Teren A., Timmis A., Van de Werf F., Wauters E., Wilde A.A.M., Ford I., Stott D.J., Algra A., Andreassi M.G., Ardissino D., Arsenault B.J., Ballantyne C.M., Bergmeijer T.O., Bezzina C.R., Body S.C., Bogaty P., de Borst G.J., Brenner H., Burkhardt R., Carpeggiani C., Condorelli G., Cooper-DeHoff R.M., Cresci S., de Faire U., Doughty R.N., Drexel H., Engert J.C., Fox K.A.A., Girelli D., Hagström E., Hazen S.L., Held C., Hemingway H., Hoefer I.E., Hovingh G.K., Johnson J.A., de Jong P.A., Jukema J.W., Kaczor M.P., Kähönen M., Kettner J., Kiliszek M., Klungel O.H., Lagerqvist B., Lambrechts D., Laurikka J.O., Lehtimäki T., Lindholm D., Mahmoodi B.K., Maitland-van der Zee A.H., McPherson R., Melander O., Metspalu A., Pepinski W., Olivieri O., Opolski G., Palmer C.N., Pasterkamp G., Pepine C.J., Pereira A.C., Pilote L., Quyyumi A.A., Richards A.M., Sanak M., Scholz M., Siegbahn A., Sinisalo J., Smith J.G., Spertus J.A., Stewart A.F.R., Szczeklik W., Szpakowicz A., Ten Berg J.M., Thanassoulis G., Thiery J., van der Graaf Y., Visseren F.L.J., Waltenberger J., Van der Harst P., Tardif J.C., Sattar N., Lang C.C., Paré G., Brophy J.M., Anderson J.L., März W., Wallentin L., Cameron V.A., Horne B.D., Samani N.J., Hingorani A.D., Asselbergs F.W. Association of Chromosome 9p21 with Subsequent Coronary Heart Disease Events: A GENIUS-CHD Study of Individual Participant Data. Circ Genom Precis Med. 2019. Vol. 12: e002471. DOI: 10.1161/CIRCGEN.119.002471.

На фоне значительного прогресса противоопухолевой терапии, позволяющего улучшить качество и продолжительность жизни больных онкологическими заболеваниями [1], антрациклиновые препараты по-прежнему сохраняют свою актуальность как для научных исследований, так и для клинической практики [2]. Антрациклиновые антибиотики (доксорубицин, даунорубицин, эпирубицин и идарубицин) являются неотъемлемой частью многих схем лекарственной терапии рака молочной железы, лимфомы, лейкемии и саркомы, поскольку обладают широким спектром действия [3].

Терапевтическая эффективность антрациклинов сопряжена с развитием различных осложнений, среди которых наиболее распространенным является кардиотоксичность. Антрациклин-опосредованную кардиотоксичность (АОК) относят к I типу кардиотоксичности (миокардиальное повреждение), выраженному в виде апоптотической или некротической гибели кардимиоцитов [2].

АОК в зависимости от формы и времени клинического проявления подразделяется на три типа: острая (от момента введения антрациклиновых препаратов и в течение всего лечения), ранняя хроническая (в течение 1 года после завершения химиотерапевтического лечения) и поздняя хроническая кардиотоксичность (более чем через 1 год после прекращения химиотерапии) [4].

Острая кардиотоксичность характеризуется снижением сократительной способности миокарда и может быть обратима в течение одной недели после прекращения антрациклиновой терапии. Чаще всего острая АОК приводит к таким осложнениям, как гипотония, перикардит, миокардит, наджелудочковая, желудочкая и синусовая тахикардия, и сопровождается электрокардиографическими ST-T изменениями, увеличением уровня мозгового натрийуретического пептида и сердечного тропонина. Однако такой тип кардиотоксичности встречается крайне редко и наблюдается у менее 1% больных [4].

Ранняя хроническая кардиотоксичность проявляется в виде систолической или диастолической желудочковой дисфункции. По разным литературным данным, такой тип АОК отмечается в 5-35% случаев. У большинства взрослых пациентов ранняя хроническая кардиотоксичность связана с развитием дилатационной кардиомиопатии и уменьшением массы и стенки левого желудочка. Типичным проявлением кардиомиопатии является прогрессирующее уменьшение фракции выброса. К другим возможным событиям относят нарушения ритма и проводимости сердца, повреждения сердечных клапанов и снижение сократимости [4].

Поздняя хроническая кардиотоксичность принимает форму сердечной дисфункции. Отличительной особенностью поздней хронической АОК является ее бессимптомность в течение длительного периода, за которым следует дилатационная и рестриктивная кардиомиопатия и в конечном итоге – развитие застойной сердечной недостаточности. При данном типе смертность больных превышает 50% [4].

Накопленные данные о механизмах развития АОК [5] свидетельствуют о большом значении непатогенных аллелей ряда генов, участвующих в развитии АОК в ходе химиотерапии онкологических заболеваний.

Цель настоящего исследования заключалась в исследовании распространенности полиморфных вариантов, для которых описан повышенный риск антрациклин-индуцируемой кардиотоксичности (АОК), у пациенток с онкопатологией молочной железы.

Материал и методы исследования

В исследование были включены 80 женщин с диагнозом РМЖ, европеоидного типа, в возрасте от 32 до 65 лет (медиана возраста – 55 лет), проходивших лечение на базе ФГБУ «РНИОИ». Для всех пациенток было показано проведение химиотерапии с антрациклиновыми антибиотиками по схеме: доксорубицин 60 мг/м2+эндоксан 600 мг/м2 в/в капельно в 1 день каждые 3 недели (4 курса АС). Суммарная доза доксорубицина не превышала 50 мг/м2. Все лица, вошедшие в исследование, дали информированное письменное согласие на участие в нём.

В работе использовали периферическую кровь, забор которой осуществляли в вакуумные пробирки GreenVac-Tube (Корея) с ЭДТА-К2. Выделение ДНК осуществляли с помощью набора «ДНК-сорб В» («АмплиСенс», Россия) согласно протоколу производителя. Концентрацию ДНК измеряли на флюориметре Qubit 2.0® с использованием набора Quant-iT™ dsDNAHigh-Sensitivity (HS) AssayKit (Invitrogen, США).

Идентификацию SNP (Single nucleotide polymorphism) - rs8187710 ABCC2, rs11549465 HIF1A, rs1333049 CDKN2A/B и rs28714259, проводили методом HRM-PCR (High Resolution Melt Polymerase chain reaction) на амплификаторе CFX96 (Bio-Rad, США) согласно рекомендациям производителя. Наличие полиморфизма подтверждалось секвенированием по Сэнгеру на автоматическом генетическом анализаторе 3500 Genetic Analyzer (ABI, США). Прямые и обратные праймеры для HRM-PCR и амплификации секвенируемых фрагментов были разработаны нами с использованием соответствующих референсных последовательностей NCBI GenBank в программе BLAST (табл. 1).

Статистический анализ проводили с помощью пакета программ Statistica 10.0 (StatSoftInc, США). Для оценки достоверности различий использовали непараметрический критерий χ2.

Таблица 1

Праймеры, используемые для HRM-анализа и секвенирования по Сэнгеру в настоящем исследовании

Ген,

полиморфизм

HRM

(5’→3’)

Секвенирование по Сэнгеру

(5’→3’)

rs28714259

Прямой:

TGACTCAGCAGCACTCTACAA

Обратный:

GGATGGATGGCAGAAGCCAA

Прямой:

TGACCCCTTCAGAGTTTCCT

Обратный:

TGTGGGGAAAAGGAGGTCTC

АВСС2

rs8187710

Прямой: TGGTCCTAGACAACGGGAAGA

Обратный: AAGGGTCCAGGGATTTGTAGC

Прямой: AGCCTTGTCTGACTATACCACA

Обратный:

CTGCTAGAATTTTGTGCTGTTCA

HIF1A

rs11549465

Прямой: TCCAGTTACGTTCCTTCGATCA

Обратный:

TGAGGACTTGCGCTTTCAGG

Прямой:

GGACACAGATTTAGACTTGGAGA

Обратный:

ATTCATCAGTGGTGGCAGTG

CDKN2A/В

rs1333049

Прямой:

ACCCTACTGTCATTCCTCATACT

Обратный:

TCTTGCTTACCTCTGCGAGTG

Прямой:

TGACCTTCATGCTATTTTGAGGA

Обратный:

TTGCTTACCTCTGCGAGTG

 

Результаты исследования и их обсуждение

Частоты аллелей и генотипов трёх исследованных полиморфизмов в сравнении с данными популяционной базы 1000Genome приведены в таблице 2.

Из 80 пациенток 22 (29%) обладали wild type по всем четырем SNP. По всем полиморфизмам преобладали гетерозиготные генотипы; только для гена CDKN2A/B были отмечены 7 гомозиготных генотипов (9%).

Таблица 2

Частота исследованных полиморфизмов в группе пациенток с РМЖ и в европейской популяции (1000Genome)

Популяция

Ген

Полиморфизм

Частота генотипов

Частота аллелей

Пациентки с РМЖ южнорусской популяции

АВСС2

rs8187710

GG = 0,870

GA = 0,130

АА = 0,000

G = 0,930

А = 0,070

HIF1A

rs11549465

СС = 0,850

СТ = 0,150

ТТ = 0,000

С = 0,925

Т = 0,075

CDKN2A/В

rs1333049

GG = 0,400

GC = 0,510

СС = 0,090

G = 0,650

С = 0,350

Европейская

популяция

АВСС2

rs8187710

GG = 0,865

GA = 0,130

АА = 0,005

G = 0,930

А = 0,070

HIF1A

rs11549465

СС = 0,858

СТ = 0,133

ТТ = 0,090

С = 0,925

Т = 0,075

CDKN2A/В

rs1333049

GG = 0,292

GC = 0,504

СС = 0,204

G = 0,544

С = 0,456

 

Анализ индивидуальных генотипов выявил случаи сочетания трех различных полиморфизмов: в одном случае (1,25%) обнаружено одновременное присутствие rs8187710, rs1333049 и rs28714259 (генотипы GA, GC и GA соответственно), в двух случаях (2,5%) - rs11549465, rs1333049 и rs28714259 (генотипы СТ, GC и GA соответственно) и в одном случае (1,25%) - rs8187710, rs11549465 и rs1333049 (генотипы GA, СТ и GC соответственно).

Частота встречаемости аллелей и генотипов генов АВСС2 и HIF1A в исследуемой группе пациенток была сопоставимой с таковой в европейской популяции (табл. 2). В то же время распространенность rs1333049 CDKN2A/В в южнорусской популяции больных РМЖ была достоверно ниже (р=0,007) по сравнению с европейской популяцией.

На момент написания статьи информация об аллеле rs28714259 в SNP базах данных отсутствовала, что, очевидно, связано с небольшим сроком, прошедшим после описания ассоциации данного SNP с высоким риском антрациклин-опосредованной сердечной недостаточности [6-8]. Однонуклеотидный полиморфизм rs28714259 (A>G) локализован в некодирующей области 15 хромосомы. Данная область взаимодействует с другими удаленными элементами генома и участвует в регуляции сигнального пути глюкокортикоидов [6]. В работе Schneider и сотрудников было показано, что гетерозиготные и гомозиготные генотипы по rs28714259 коррелируют с риском развития антрациклин-опосредованной сердечной недостаточности (ОШ = 1,9, p = 0,04) и снижением фракции выброса левого желудочка (ОШ = 4,2, р = 0,018) [6]. В нашем исследовании аллельная частота встречаемости rs28714259 составила 0,09 с преобладанием генотипа wild type (GG – 0,81 против GA – 0,19) и отсутствием гомозигот по альтернативному аллелю.

Кодирующие гены, полиморфизмы которых идентифицировали в этой работе, выполняют разнообразные функции в клетке.

АВСС2 кодирует белок MRP2, относящийся к семейству АТФ-связывающих кассетных транспортеров, которые способны переносить антрациклины через цитоплазматическую мембрану. Согласно результатам исследования Armenian S.H. и сотрудников, наличие rs8187710 коррелирует с высоким риском антрациклин-опосредованной кардиотоксичности (ОШ: 5,22, 95% ДИ: 1,92-13,84, p = 0,02) у пациентов с гематологическими заболеваниями, которым была проведена трансплантация гематопоэтических клеток. Суммарно частота гетеро- и гомозиготных генотипов (GA, AA) в исследуемой группе составляла 20,8% [5]. Wojnowski L. и сотрудники сообщали, что у носителей генотипов GA и АА по rs8187710 гена АВСС2 риск острой антрациклин-опосредованной кардиотоксичности был в 2,3 раза выше (ОШ: 2,3, 95% ДИ: 1,0-5,4, р = 0,06), при этом частота GA и АА составляла 23,5% [9].

Факторы, индуцируемые гипоксией (HIF), представляют собой белки, которые быстро аккумулируются при гипоксии и осуществляют транскрипционный контроль над широким спектром генов-мишеней [10]. Полиморфизм 1772C>T (rs11549465) обуславливает замену пролина на серин в домене кислородзависимой деградации. Белок с такой заменой обладает повышенной трансактивационной способностью в условиях как гипоксии, так и нормоксии. Известно, что наличие минорного аллеля «Т» обуславливает высокий риск аневризмы большой аорты в сочетании с патологией периферических артерий (ОШ = 2,02; р = 0,009) [11]. Кроме rs11549465 в исследованной области гена HIF1A был идентифицирован в одном случае не патогенный SNP rs34005929 (g.50435G>A); установлено шесть носителей миссенс-варианта rs11549467 (g.50457G>A), часто описываемого в связи с повышенным риском развития онкопатологии [12; 13], и у одной пациентки был определен гетерозиготный генотип по полиморфизму rs61755645, ассоциированному как с риском преэклампсии, так и с развитием неоплазии ротовой полости [12].

Ген CDKN2A/B кодирует два белка - опухолевые супрессоры p16INK4A и р14ARF, регулирующие сигнальные пути р53 и RB1. Предполагается, что носители генотипа СС при полиморфизме rs1333049 (G>C) CDKN2A/B обладают предрасположенностью к внезапной смерти от остановки сердца (ОШ: 1,7, 95% ДИ: 1,1-2,8, p = 0,019) [14]. В более позднем мультицентровом исследовании было установлено, что наличие аллеля «C» сопряжено с риском развития острого коронарного синдрома [15].

Пациентки, вошедшие в наше исследование, продолжают наблюдаться. Ввиду непродолжительного периода наблюдения оценка ранней и поздней АОК будет выполнена в 2020-2021 гг. Отметим, что у пациентки (1,25%), гетерозиготной по rs13058338, rs28714259 и гомозиготной по rs1333049, была выявлена острая АОК в виде кардиопатии после первого курса антрациклинов.

Заключение. Выявленное в выборке пациенток с РМЖ распределение частот генетических полиморфизмов и генотипов по rs8187710 ABCC2, rs11549465 HIF1A соответствует показателям европейской популяции, и статистически достоверно реже встречается аллель rs1333049 CDKN2A/B. Кроме того, особый интерес представляет первая оценка популяционной представленности rs28714259 (0,09, генотипы GG – 0,81 против GA – 0,19). Идентифицированный случай антрациклин-опосредованной кардиопатии с характерным сочетанием трех полиморфных локусов дает возможность предположить многофакторный генез АОК и определяет перспективность дальнейших исследований выбранных полиморфизмов.

Финансирование осуществлялось в рамках госзадания «Молекулярно-генетические предикторы сердечно-сосудистых осложнений у больных раком молочной железы, подвергнутых лекарственной терапии».


Библиографическая ссылка

Гвалдин Д.Ю., Омельчук Е.П., Новикова И.А., Ратиева А.С., Ващенко Л.Н., Тимошкина Н.Н., Владимирова Л.Ю. ИССЛЕДОВАНИЕ ГЕНЕТИЧЕСКИХ ПОЛИМОРФИЗМОВ, АССОЦИИРОВАННЫХ С РАЗВИТИЕМ АНТРАЦИКЛИН-ОПОСРЕДОВАННОЙ КАРДИОТОКСИЧНОСТИ, У ПАЦИЕНТОК С ОНКОПАТОЛОГИЕЙ МОЛОЧНОЙ ЖЕЛЕЗЫ // Современные проблемы науки и образования. – 2019. – № 4. ;
URL: https://science-education.ru/ru/article/view?id=29109 (дата обращения: 20.05.2022).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074