Сетевое издание
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,940

ГЕНДЕРНЫЕ ОСОБЕННОСТИ ЭКСПРЕССИИ ГЕНЕТИЧЕСКИХ ЛОКУСОВ В ТКАНЯХ ГЛИОМ

Кит О.И. 1 Пушкин А.А. 1 Росторгуев Э.Е. 1 Поркшеян Д.Х. 1 Франциянц Е.М. 1 Кузнецова Н.С. 1 Черкиев И.У. 1 Водолажский Д.И. 1
1 Федеральное государственное бюджетное учреждение "Ростовский научно-исследовательский онкологический институт" Министерства здравоохранения российской федерации
Глиомы – наиболее распространенные первичные опухоли мозга у взрослых пациентов, возникающие с частотой приблизительно 5 случаев в год на 100 000 человек, по данным ВОЗ. Около 70% всех глиом обладают свойствами злокачественных опухолей; 5-летний рубеж выживаемости преодолевают лишь 20% пациентов с глиомой. Для многих онкологических заболеваний проявляются гендерные различия по показателям распространенности и смертности независимо от расы или возраста. Онкологические заболевания, которые затрагивают как мужчин, так и женщин во всех локализациях и органных системах, часто характеризуются коэффициентами мужской и женской заболеваемости, которые варьируются от примерно 1,5:1 до 3:1. В рамках настоящего исследования методом RT-qPCR определяли величины гендерных особенностей в операционных биоптатах для показателей относительной экспрессии 15 генетических локусов: EGFR, SMAD4, SMAD7, SMO, NOTCH1, NOTCH2, HBP1, HIF1A, EGLN1, EGLIN3, KDM1B, KDM1A, MSI1, MSI2, TET1. Показано, что изменения в уровнях экспрессии генетических локусов EGFR, SMO, NOCH1 и KDM1B при малигнизации клеток мозга у пациентов мужского и женского пола имеют разнонаправленный (увеличивающийся у пациентов мужского пола и уменьшающийся у пациентов женского пола) характер и должны учитываться при формировании групп риска при проведении плановой химиотерапии.
гендерный статус
глиома
экспрессия генов
RT-PCR
1. Кит О.И., Водолажский Д.И., Росторгуев Э.Е., Франциянц Е.М., Панина С.Б. Молекулярно-генетические маркеры глиом // Молекулярная генетика, микробиология и вирусология. 2017. № 4. С. 132-140.
2. Кит О.И., Водолажский Д.И., Расторгуев Э.Е., Франциянц Е.М., Поркшеян Д.Х., Панина С.Б. Мультиформная глиобластома: патогенез и молекулярные маркеры // Вопросы онкологии. 2017. № 5. С. 695-702.
3. Cancer Research UK [Электронный ресурс]. URL: http://www.cancerresearchuk.org/cancer-info/cancerstats/incidence (дата обращения: 25.09.2018).
4. Siegel R., DeSantis C., Virgo K., Stein K., Mariotto A., Smith T., Cooper D., Gansler T., Lerro C., Fedewa S., Lin C., Leach C., Cannady R.S., Cho H., Scoppa S., Hachey M., Kirch R., Jemal A., Ward E. Cancer treatment and survivorship statistics. CA Cancer J. Clin. 2012. no 62. Р. 220-241.
5. Кит О.И., Водолажский Д.И., Кутилин Д.С., Никитин И.С., Моисеенко Т.И., Франциянц Е.М. Аберрантная транскрипционная активность апоптоз-регулирующих генов при малигнизации тканей тела матки // Молекулярная медицина. 2018. Т. 16. № 1. С. 25-31.
6. Xiaohua Yan, Hongwei Liao, Minzhang Cheng, Xiaojing Shi, Xia Lin, Xin-Hua Feng, and Ye-Guang Chen. Smad7 Protein Interacts with Receptor-regulated Smads (R-Smads) to Inhibit Transforming Growth Factor-β (TGF-β). Smad Signaling. J. Biol. Chem. 2016. no 291(1). Р. 382-392.
7. Yewale C., Baradia D., Vhora I., Patil S., Misra A. Epidermal growth factor receptor targeting in cancer: a review of trends and strategies. Biomaterials. 2013. 34(34). Р. 8690-8707. DOI: 10.1016/j.biomaterials.2013.07.100.
8. Lan F., Nottke A.C., Shi Y.: Mechanisms involved in the regulation of histone lysine demethylases. Curr. Opin. Cell. Biol. 2008. no 20. Р. 316-325.
9. Schulte J.H., Lim S., Schramm A., Friedrichs N., Koster J., Versteeg R., Ora I., Pajtler K., Klein-Hitpass L., KuhfittigKulle S., Metzger E., Schule R., Eggert A., Buettner R., Kirfel J.. Lysine-specific demethylase 1 is strongly expressed in poorly differentiated neuroblastoma: implications for therapy. Cancer Res. 2009. no 69. Р.2065-2071.
10. Hayami S., Kelly J.D., Cho H.S., Yoshimatsu M., Unoki M., Tsunoda T., Field H.I., Neal D.E., Yamaue H., Ponder B.A., Nakamura Y., Hamamoto R. Overexpression of LSD1 contributes to human carcinogenesis through chromatin regulation in various cancers. Int. J. Cancer. 2011. no 128. Р.574-586.

Глиомы относятся к наиболее распространенным инвазивным первичным опухолям мозга у взрослых пациентов и характеризуются высокими уровнями смертности и рецидивирования после хирургического удаления. Этот вид опухолей встречается с частотой приблизительно 5 пациентов в год на 100 000 человек в мире. Глиомы поражают головной и спинной мозг и возникают в результате онкотрансформации глиальных клеток [1]. Приблизительно 70% всех глиом относятся к злокачественным. Лишь 20% пациентов с данным заболеванием преодолевают 5-летний рубеж выживаемости [2]. За некоторыми исключениями, по показателям распространенности и смертности от опухолевых заболеваний гендерные различия во всем мире проявляются независимо от расы или возраста. Онкологические заболевания, которые затрагивают как мужчин, так и женщин во всех локализациях и органных системах, часто характеризуются коэффициентами мужской и женской заболеваемости, которые соотносятся от примерно от 1,5:1 до 3:1 [3]. Мужчины не только чаще болеют онкологическими заболеваниями, они также часто проявляют более плохие (по сравнению с женщинами) ответы на терапию по показателям как общей, так и бессобытийной выживаемости [4]. Поэтому изучение гендерных особенностей в течении онкологических заболеваний поможет выявить фундаментальные различия в основных механизмах инициирования, прогрессии опухолей и возможного терапевтического ответа. Благодаря подобного рода исследованиям могут быть выделены четкие связи между гендерными различиями и конкретными онкогенными механизмами или молекулярными подтипами рака, а также связь между гендерными различиями и предполагаемыми ответами на терапевтические воздействия при лечении опухолей. Поэтому целью настоящего исследования послужило исследование гендерных особенностей в показателях транскрипционной активности некоторых генетических локусов глиом головного мозга для определения потенциальных молекулярных и клеточных механизмов/мишеней, через которые гендерные различия пациентов влияют на биологию и особенности клинических проявлений онкологических заболеваний.

Материалы и методы

В исследовании были использованы операционные биоптаты опухолевых тканей головного мозга, прилегающих к ним перифокальных участков (5 мм от опухоли) и не малигнизированных (условная норма) тканей, взятых в процессе операционного вмешательства у 21 пациента (12 мужчин и 9 женщин) в возрасте 36-67 лет, поступивших на лечение в ФГБУ «РНИОИ» МЗ РФ в 2017–2018 гг. Каждое исследование было одобрено этическим комитетом ФГБУ «РНИОИ»; было получено добровольное информированное согласие каждого пациента на включение его в данное исследование.

Последовательности праймеров, использованных в данном исследовании

Название генетического локуса

Последовательности праймеров 5’®3’

Forward

Reverse

1

EGFR

AGGACGGGGACCAGACAA

CTGCGTACTTCCAGACCAGG

2

SMAD4

GGATACGTGGACCCTTCTGG

ATGTGCAACCTTGCTCTCTCA

3

SMAD7

GCAGACTGTCCAGATGCTGTG

AAGAAGTTGGGAATCTGAAAGCC

4

SMO

CTGAAGGCTGCACGAATGAG

CTTGGGGTTGTCTGTCCGAA

5

NOTCH1

CCTGCCTGTCTGAGGTCAATG

AGTCGCACTTGTACCCGTTG

6

NOTCH2

AATGTTACAGCAGCCCTTGC

AATTAACCCCTGACGTGCCT

7

HBP1

TGGGCATTCACAAGGGCTATG

AGTCAACTTCAGTACAGACTCGC

8

HIF1A

CCATGCCCCAGATTCAGGAT

GGACTATTAGGCTCAGGTGAACT

9

EGLIN1

AGACTGGGATGCCAAGGTAAG

CAATGTCAGCAAACTGGGCT

10

EGLIN3

TCATAGCAGATGTGGAGCCC

GCATATCTGGTTGCGTAAGAGG

11

KDM1A

GCTACACGGCTTCAGGATGT

GGGTACAGAGAACTGCGTCG

12

KDM 1B

GTGTGAACAAGTATCTGCTCG

AATGTCAAGCCCTTCTGCCA

13

MSI1

GGCTGTGGTTCGAGGGAC

CTGGGAGTCGAACCTGGAG

14

MSI2

GCAGACCCAGCAAGTGTAGA

CGAGGAAATGCAACTTTGGGG

15

TET1

GGAAAACAAGAGGCCCCAGA

ACTTGGGGCCATTTACTGGT

16

PSMC4*

CGCTCACGCATTTCGAGC

CAGGTGGGCCATACATGAGG

17

RPL0*

GAGGAAACTCTGCATTCTCGC

CTGCAGACAGACACTGGCA

18

TBP*

GTGCCCGAAACGCCGAA

GTGGTTCGTGGCTCTCTTATCC

*Референсные гены.

Для транспортировки в лабораторию и хранения образцы мгновенно замораживали в жидком азоте без использования криотранспортных РНК-сред. Максимальное время от момента взятия образца до его заморозки в жидком азоте составляло не более 20 с. Фрагменты тканей гомогенизировали в фарфоровых ступках в лизирующем растворе, содержащем 4 М гуанидин тиоцианат, 25 мМ цитрат натрия, 0,5% саркозил и 0,1 М 2-меркаптоэтанол в соответствии с методом P. Chomczynski и N. Sacchi. Полученные образцы суммарной РНК обрабатывали препаратами ДНК-азы для удаления следов геномной ДНК. [5] С использованием коммерческих наборов Reverta-L («Интерлабсервис», Россия) проводили синтез кДНК. Величины относительной экспрессии 15 генетических локусов: EGFR, SMAD4, SMAD7, SMO, NOTCH1, NOTCH2, HBP1, HIF1A, EGLN1, EGLIN3, KDM1B, KDM1A, MSI1, MSI2, TET1 (таблица) определяли методом RT-qPCR. После серии предварительных экспериментов в качестве референсных использовали гены PSMC, TBP и RPLO. С помощью программы geNorm оценивалась стабильность экспрессии при подборе референсных генов. С использованием референсных последовательностей NCBI GenBank и программы Primer-BLAST осуществлялся дизайн специфичных олигонуклеотидных праймеров [6].

С использованием пакета прикладных статистических программ Microsoft Excel 2013 (Microsoft Corporation, США) и Statistica 8.0 (StatSoft Inc., США) осуществляли статистический анализ результатов. С помощью непараметрического критерия Манна-Уитни и с использованием коэффициента корреляции Спирмена оценивали достоверность отличий и проводили корреляционный анализ полученных результатов. При пороговом уровне p<0,05 отвергали нулевую статистическую гипотезу об отсутствии различий.

Результаты исследования и их обсуждение

В рамках проведенного нами исследования, с точки зрения возможной специфики гендерных различий в паттернах экспрессии, исследованные генетические локусы можно условно разделить на две группы. Группа № 1 – в этой группе изменения в показателях экспрессии генетических локусов в тканях глиом головного мозга у пациентов мужского и женского пола носили разнонаправленный характер. То есть если у пациентов мужского пола наблюдалось увеличение относительной экспрессии некоторых исследованных генетических локусов в тканях глиом, то у пациенток женского пола в аналогичных тканях наблюдалось уменьшение транскрипционной активности того же локуса, а объединенная выборка пациентов мужского и женского пола давала результирующую величину экспрессии данного локуса, приблизительно равную показателям контроля (т.е. не опухолевой ткани). К первой группе исследованных генетических локусов в рамках проведенного нами исследования относятся локусы EGFR и KDM1B (рисунок). Различия в уровнях экспрессии гена EGFR в опухолевой ткани между пациентами мужского и женского пола отличались приблизительно в 2,5 раза (у мужчин этот показатель больше) и были статистически достоверны для уровня значимости p=0,0058.

Паттерны относительной экспрессии генов в опухолевой ткани (относительно нормальной) у пациентов женского и мужского пола (n=21)

Уровень экспрессии локуса KDM1B у пациентов мужского пола превышал аналогичный показатель у пациентов женского пола приблизительно в 3 раза. Данные различия также были статистически достоверны для уровня значимости p=0,0042. Это свидетельствует о том, что для опухолевых тканей мозга (глиом) пациентов мужского пола препараты, таргетирующие рецепторы EGFR, будут в среднем (но не для каждого отдельно взятого пациента) эффективнее аналогичных препаратов, используемых для лечения пациентов женского пола. Для использования алкилирующих препаратов при лечении глиом (например, темозоломид) можно сделать противоположный вывод: применение алкилирующих агентов при лечении глиом будет намного эффективнее у пациентов женского пола. Вторая группа исследованных локусов включает в себя те локусы, транскрипционная активность которых в опухолевой ткани статистически достоверно (или на уровне тенденции) отличается от контрольных показателей однонаправленно как у пациентов мужского, так и женского пола. В рамках проведенного нами исследования к таким локусам можно отнести SMAD7, HIF1A, EGLN1, EGLN3. К третьей группе исследованных нами генетических локусов нужно отнести те локусы, транскрипционная активность которых в тканях глиом не отличалась в различных гендерных группах: SMAD4, SMO, NOTCH1, NOTCH2, HBP1, KDM1A, MSI1, MSI2 и TET1 (рисунок). С точки зрения потенциального использования того или иного локуса в качестве маркера прогрессии или малигнизации, а также мишени для терапевтических воздействий, потенциально пригодными можно считать локусы, транскрипционная активность которых достоверно отличается от контрольных показателей. В рамках нашего исследования, в пределах выборки пациентов мужского пола к таким генетическим локусам относятся: SMAD7 (p=0,000047), EGLN1 и EGLN3 (p=0,00085 и p=0,036 соответственно). У пациентов женского пола к таким генетическим локусам относится только генетический локус EGLN1 (p<0,004). При этом необходимо отметить, что в рамках проведенного нами исследования показатели вариабельности для показателей транскрипционной активности исследованных нами генетических локусов (средние квадратические отклонения или d2) в среднем для показателей нормальной ткани у мужчин превышали аналогичные показатели рядов данных для пациентов женского пола в 9 раз, а для опухолевой ткани – в 22 раза. При использовании F-теста статистически достоверные различия (для уровня p=0,031) по показателям вариабельности рядов между нормальными тканями пациентов разного пола (мужчины/женщины) были получены для локусов NOTCH2, HBP1, EGLN3 и KDM1B. Аналогичный анализ по опухолевым тканям (глиома) показал, что различия по вариабельности рядов данных между пациентами мужского и женского пола наблюдались для локусов EGFR, SMAD4 и NOTCH1. При этом для локуса SMAD4 показатели вариабельности данных были меньше у пациентов мужского пола.

Белок, кодируемый этим геном, представляет собой ядерный белок, который связывает E3 ubiquitin ligase SMURF2. После связывания этот комплекс транслоцируется в цитоплазму, где он взаимодействует с TGF-бета-рецептором типа-1 (TGFBR1), что приводит к деградации как кодируемого этим геном белка, так и TGFBR1. Экспрессия этого гена индуцируется TGFBR1. Вариации этого гена являются причиной восприимчивости к колоректальному раку 3-го типа (CRCS3). Для этого гена были найдены несколько вариантов транскрипции, кодирующих различные изоформы. В рамках проведенного нами исследования транскрипционная активность гена SMAD7 в тканях глиом как мужчин, так и женщин была ниже показателей не опухолевых тканей приблизительно в 2,5 раза, а также в объединенной выборке пациентов мужского и женского пола. Однако отклонение транскрипционной активности гена SMAD7 от показателей контроля в тканях глиом мужчин было статистически достоверным для уровня p=0,000041, в то время как для пациентов женского пола этот показатель составлял всего лишь p=0,156317809, что свидетельствует о значительно большей неоднородности показателей у пациентов женского пола.

Терапевтическое таргетирование рецептора эпидермального фактора роста (EGFR) показано при лечении онкологических заболеваний, и применение многих фармацевтических препаратов для этих целей одобрено отдельно или в сочетании с химиотерапией для лечения колоректального рака, немелкоклеточного рака легкого и рака поджелудочной железы, но не для глиом [7]. Утвержденными препаратами являются в основном тирозинкиназные ингибиторы (TKI), мешающие сигнальной трансдукции рецептора, или моноклональные антитела, таргетирующие этот рецептор на поверхности клетки, чтобы препятствовать связыванию им лиганда. В рамках настоящего исследования нами было установлено, что экспрессия гена EGFR в глиомах пациентов женского и мужского пола статистически достоверно различается (рисунок): в глиомах пациентов мужского пола экспрессия гена EGFR имеет тенденцию к увеличению, а в глиомах пациентов женского пола – к подавлению экспрессии. Гендерные различия статистически достоверны для уровня p=0,0075. Таким образом, имеющие место гендерные различия в уровнях экспрессии гена EGFR в тканях глиом могут быть положены в основу формирования групп риска терапевтических воздействий при лечении данного заболевания.

Ген лизин-специфической деметилазы-1 (KDM1, также известная как LSD1, AOF2 или BHC110) кодирует флавин-зависимую моно-аминоксидазу, которая может деметилировать моно- и диметилированные лизины, в частности гистон H3, лизины 4, 9, 27 и 36 [8]. KDM1 высоко-консервативен у эукариот и необходим для осуществления многих физиологических функций. KDM1 сверхэкспрессируется при разных типах рака, включая нейробластомы [9], раки простаты, молочной железы и толстой кишки [10].

Результаты исследований показывают, что аберрантная экспрессия гена KDM1 происходит во время прогрессирования глиомы с наибольшей экспрессией в глиомах с высоким уровнем дифференцировки. Фармакологическое ингибирование активности KDM1 или нокдаун его экспрессии через siRNA в модельных условиях уменьшает пролиферацию клеток глиом. Ингибиторы KDM1 способствуют апоптозу клеток глиом путем активации сигнального пути p53. В рамках настоящего исследования (рисунок) нами установлено разнонаправленное изменение транскрипционной активности гена KDM1B в глиомах у пациентов женского и мужского пола: у пациентов мужского пола транскрипционная активность гена KDM1B увеличивалась, а у пациентов женского пола – уменьшалась приблизительно в 2 раза. Различия в экспрессии этого генетического локуса были статистически достоверны для уровня p=0,027. В рамках проведенного нами исследования статистически значимых и достоверных различий в уровнях транскрипционной активности исследованных нами генетических локусов в зависимости от уровня дифференцировки клеток (Grade) обнаружить не удалось. С точки зрения кросс-корреляции исследованных локусов у пациентов мужского и женского пола можно сделать вывод о значительных различиях этого показателя для пациентов мужского и женского пола: если для пациентов мужского пола малигнизация тканей мозга служит десинхронизирующим фактором, то для пациентов женского пола – синхронизирующим.

Таким образом, результаты исследования выявили системные различия в процессах малигнизации тканей мозга у пациентов мужского и женского пола, которые необходимо учитывать при организации лечебного процесса (химиотерапия) и формировании групп риска пациентов.


Библиографическая ссылка

Кит О.И., Пушкин А.А., Росторгуев Э.Е., Поркшеян Д.Х., Франциянц Е.М., Кузнецова Н.С., Черкиев И.У., Водолажский Д.И. ГЕНДЕРНЫЕ ОСОБЕННОСТИ ЭКСПРЕССИИ ГЕНЕТИЧЕСКИХ ЛОКУСОВ В ТКАНЯХ ГЛИОМ // Современные проблемы науки и образования. – 2018. – № 5. ;
URL: https://science-education.ru/ru/article/view?id=28068 (дата обращения: 05.12.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074