Электронный научный журнал
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,931

ПОКАЗАТЕЛЬ КОПИЙНОСТИ ГЕНОВ И УСТОЙЧИВОСТЬ ОПУХОЛЕВЫХ КЛЕТОК РАЗНЫХ НОЗОЛОГИЙ К ОБЛУЧЕНИЮ

Гусарева М.А. 1 Зинькович М.С. 1 Кошелева Н.Г. 1 Солнцева А.А. 1 Карнаухова Е.А. 1 Розенко Л.Я. 1 Фатькина Н.Б. 1 Потемкин Д.С. 1 Омельчук Е.П. 1 Удаленкова И.А. 1
1 Национальный медицинский исследовательский центр онкологии
Важным лечебным подходом при колоректальном раке (КРР) и раке предстательной железы (РПЖ) является лучевая терапия (ЛТ). Биологический эффект от ЛТ в большой степени зависит от первичной радиорезистентности клеток опухоли, которая может быть связана с их особыми генетическими характеристиками, в том числе с уровнем копийности некоторых генов (Copy Number Variation (CNV). Целью исследования стала валидация перечня потенциальных предикторов радиорезистентности опухолевых клеток предстательной железы и толстой кишки в условиях модельного эксперимента на основании определения вариаций количества копий генов. В исследовании использовались культуры клеток PC-3 (РПЖ) и HT-29 (аденокарцинома толстой кишки). Определение показателя относительной копийности 32 генетических локусов (XRCC4, BRCA1, BRCA2, EXO1, H2AX, KU70, RAD50, RAP80, CDK1, CDKN1B, CCND1, CCND3, FGFR2, HIST1, PTEN, AKT, RIF1, RNF168, ATM, BRIP, TP53, TOP-B1, BAX, CASP-8, CASP-3, CASP-9, MDM2, BCL-2, LIG4, RBBP8, EP-300, CFLIP) проводили методом количественной ПЦР в режиме реального времени. Обнаружено, что для клеток PC-3 радиорезистентность ассоциирована с увеличенным количеством копий генов XRCC4, EP-300, CDK1, CDKN-1B, PTEN и RBBP8 и сниженным количеством копий генов TP53, CCND3 и BCL-2, а для клеток НТ-29 – с увеличенным количеством копий генов RBBP8, BRCA2, H2AX, CASP-9 и сниженным количеством копий генов BCL-2. Таким образом, проведенное исследование позволило установить, что клетки линий PC-3 и НТ-29, сохранившие после пятидневной ЛТ при 7 Гр жизнеспособность, обладают измененной копийностью генов, которые обеспечивают работу ключевых сигнальных путей, регулирующих репарацию ДНК, апоптоз и клеточный цикл.
лучевая терапия
культура клеток
рак предстательной железы
колоректальный рак
копийность генов
апоптоз
репарация днк
1. Зинькович М.С., Максимов А.Ю., Розенко Л.Я., Гусарева М.А., Карнаухова Е.А., Фаенсон А.В., Тимошкина Н.Н., Кутилин Д.С. Радиорезистентность как фактор эволюции лучевой терапии рака предстательной железы // Современные проблемы науки и образования. 2019. №2. URL: http://science-education.ru/ru/article/view?id=28627 (дата обращения: 04.08.2020).
2. Кутилин Д.С., Кошелева Н.Г., Максимов А.Ю., Гусарева М.А., Бондаренко Е.С., Сагакянц А.Б., Донцов В.А., Габричидзе П.Н., Черняк М.Н., Гречкин Ф.Н., Мезенцев С.С., Ульянова Е.П., Полуэктов С.И. Влияние различных доз лучевой терапии на выживаемость клеток аденокарциномы толстой кишки линии HT-29 // Современные проблемы науки и образования. 2019. № 3; URL: http://www.science-education.ru/ru/article/view?id=28918 (дата обращения: 04.08.2020).
3. Chaiswing L., Weiss H.L., Jayswal R.D. Profiles of Radioresistance Mechanisms in Prostate Cancer. Crit. Rev. Oncog. 2018. Vol. 23(1-2). P. 39-67.
4. Кутилин Д.С., Айрапетова Т.Г., Анистратов П.А., Пыльцин С.П., Лейман И.А., Карнаухов Н.С., Кит О.И. Изменение копийности генов в опухолевых клетках и внеклеточной ДНК у больных аденокарциномой лёгкого // Бюллетень экспериментальной биологии и медицины. 2019. Т. 167. № 6. С. 731-738.
5. Кутилин Д.С., Зинькович М.С., Гусарева М.А., Фаенсон А.В., Карнаухова Е.А., Розенко Л.Я., Фатькина Н.Б., Удаленкова И.А., Васильева Е.О., Гаппоева М.А. Копийность генов как фактор устойчивости опухолевых клеток предстательной железы к облучению // Современные проблемы науки и образования. 2020. № 4.; URL: http://science-education.ru/ru/article/view?id=29866 (дата обращения: 30.07.2020).
6. Кутилин Д.С., Могушкова Х.А. Влияние противоопухолевых антибиотиков антрациклинового ряда на транскрипционную активность раково-тестикулярных антигенов в модельном эксперименте на клеточной линии HeLa // Медицинская иммунология. 2019. Т. 21(3). С. 539-546
7. Sartori A.A., Lukas C., Coates J., Mistrik M., Fu S., Bartek J., Baer R., Lukas J., Jackson S.P. Human CtIP promotes DNA end resection. Nature. 2007. V. 450 (7169). P. 509-514.
8. Urbańska K., Orzechowski A. Unappreciated Role of LDHA and LDHB to Control Apoptosis and Autophagy in Tumor Cells. Int. J. Mol. Sci. 2019. V. 20(9). P. 2085.
9. Morgan D.L. The cell cycle: principles of control. London: New Science Press. 2007. Р. 30–31.
10. Mitrea D.M., Yoon M.K., Ou L., Kriwacki R.W. Disorder-function relationships for the cell cycle regulatory proteins p21 and p27. Biol Chem. 2012. V. 393(4). P. 259-274.
11. McCubrey J.A., Steelman L.S., Chappell W.H., Abrams S.L., Montalto G., Cervello M., Nicoletti F., Fagone P., Malaponte G., Mazzarino M. C., Candido S., Libra M., Bäsecke J., Mijatovic S., Maksimovic-Ivanic D., Milella M., Tafuri A., Cocco L., Evangelisti C., Chiarini F., Martelli A.M. Mutations and deregulation of Ras/Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR cascades which alter therapy response. Oncotarget. 2012. V. 3(9). P. 954-987.
12. Watson J. Molecular Biology of the Gene. New York: Cold Spring Harbor Laboratory Press. 2008. Р. 265-278.
13. Ntranos A., Casaccia P. Bromodomains: Translating the words of lysine acetylation into myelin injury and repair. Neuroscience Letters. 2016. V. 625. P. 4-10.
14. Кутилин Д.С., Гусарева М.А., Кошелева Н.Г., Габричидзе П.Н., Донцов В.А., Легостаев В.М., Шляхова О.В., Лиман Н.А., Солнцева А.А., Крохмаль Ю.Н. Аберрантная транскрипционная активность генов как фактор радиорезистентности клеток линии HT-29 // Современные проблемы науки и образования. 2020. № 3; URL: http://science-education.ru/ru/article/view?id=29831 (дата обращения: 04.08.2020).

За последнее десятилетие в России отмечен значительный рост уровня заболеваемости колоректальным раком (КРР) и раком предстательной железы (РПЖ). Обе нозологии вносят существенный вклад в структуру онкологической заболеваемости в Российской Федерации у мужчин разных возрастных групп [1, 2].

Основными лечебными подходами при КРР и РПЖ являются хирургические методы и лучевая терапия (ЛТ) в интеграции с химиотерапией [3]. Биологический эффект от ЛТ в большой степени зависит от исходной радиорезистентности клеток опухоли, которая связана с их особыми генетическими характеристиками [2], к которым относится и показатель копийности генов (Copy Number Variation (CNV)). CNV является особым типом генетических полиморфизмов, приводящих к изменению количества копий определенного гена и, следовательно, к изменению уровня экспрессии продукта этого гена – протеина или некодирующей РНК [4, 5]. Использование изменения показателя копийности в качестве молекулярного маркера радиорезистентности опухолевых клеток может быть перспективным направлением, которое позволит корректировать стратегию терапии [5]. Молекулярные механизмы устойчивости к ЛТ исследуются достаточно давно. Показано, что одним из них может быть гиперактивация репарации ДНК в опухолевых клетках. Известно, что баланс между повреждением и репарацией ДНК определяет выживаемость клеток после воздействия излучения. При этом не менее важным фактором, влияющим на радиорезистентность, является гипоксия, так как кислород необходим в реакции ЛТ-индуцированного образования АФК (активных форм кислорода) [5].

Метаанализ данных, полученных с 2000 по 2020 гг., опыт проведения ЛТ у больных РПЖ и КРР, а также данные по резистентности к ЛТ, ассоциированной с изменением копийности генов, позволили сформировать перечень потенциальных кандидатов на молекулярные маркеры устойчивости/чувствительности к ЛТ. Перечень включил в себя 32 генетических локуса (XRCC4, BRCA1, BRCA2, EXO1, H2AX, KU70, RAD50, RAP80, CDK1, CDKN1B, CCND1, CCND3, FGFR2, HIST1, PTEN, AKT, RIF1, RNF168, ATM, BRIP, TP53, TOP-B1, BAX, CASP-8, CASP-3, CASP-9, MDM2, BCL-2, LIG4, RBBP8, EP-300, CFLIP), ответственных за регуляцию клеточного цикла, апоптоза и репарацию ДНК.

Целью исследования стала валидация перечня потенциальных предикторов радиорезистентности опухолевых клеток предстательной железы и толстой кишки в условиях модельного эксперимента на основании определения вариаций количества копий генов.

Материалы и методы исследования

В модельном эксперименте использовались две клеточные линии – HT-29 (клетки аденокарциномы толстой кишки) и PC-3 (опухолевые клетки предстательной железы). Культивирование опухолевых клеток проходило в стерильных плоскодонных флаконах в питательной среде RPMI-1640 c добавлением 10% фетальной телячьей сыворотки и 50 мкг/мл гентамицина. Условия культивирования клеток были следующими: 5% CO2, 95% влажность и температура 370C [6].

Облучение опухолевых клеток проводилось на линейном ускорителе Novalis TX (Varian, США) в следующем режиме: разовая очаговая доза (РОД) 7 Гр последовательно 5 раз с интервалом в 24 ч (до СОД=35 Гр или изо-СОД=49 Гр). Количество клеток и соотношение живые/мертвые клетки определялось в камере Горяева с использованием 0,4%-ного раствора трипанового синего. После пятого дня облучения клетки PC-3 и HT-29 снимались с подложки раствором трипсина (Версена) [5]. Из суспензии клеток фенол-хлороформным методом проводилась экстракция ДНК по протоколу, описанному Д.С. Кутилиным и соавторами [4]. Для оценки уровня относительной копийности генов методом количественной ПЦР в режиме реального времени (Real-Time qPCR) использовались последовательности 32 пар синтетических олигонуклеотидов (XRCC4, BRCA1, BRCA2, EXO1, H2AX, KU70, RAD50, RAP80, CDK1, CDKN1B, CCND1, CCND3, FGFR2, HIST1, PTEN, AKT, RIF1, RNF168, ATM, BRIP, TP53, TOP-B1, BAX, CASP-8, CASP-3, CASP-9, MDM2, BCL-2, LIG4, RBBP8, EP-300, CFLIP) и 3 пар синтетических олигонуклеотидов для референсных генов (ACTB, B2M, GAPDH), разработанные Д.С. Кутилиным и соавторами [5] (табл. 1).

Таблица 1

Последовательности олигонуклеотидов для анализа копийности генов [5]

 

Праймер

Олигонуклеотидная последовательность

Праймер

Олигонуклеотидная последовательность

1

AKT1(F)

ATGGACAGGGAGAGCAAACGC

AKT1(R)

CTGATGCACCAGCTGACAGG

2

ATM(F)

GCAAAACCAAATGTATCAGCCTCAT

ATM(R)

GGACCAAACTACTGATTTCCTGCAT

3

BRIP1(F)

GAAGAACTTGTCAGCCTGGGGC

BRIP1(R)

GTCTTGTATTAGTTCTCGGGCTGTG

4

BRCA1(F)

GTAGCCCCTTGGTTTCCGTGT

BRCA1(R)

CCCCTTTCCCGGGACTCTACT

5

BRCA2(F)

TGCATCCCTGTGTAAGTGCATA

BRCA2(R)

CACGTACTGGGTTTTTAGCAAGC

6

CDK1(F)

CAGGGGATTGTGTTTTGTCACTC

CDK1(R)

TACCACTATTCCACTTGCCTCAT

7

CDKN1B(F)

TCGGGGTCTGTGTCTTTTGGT

CDKN1B(R)

ACTCCCGTTAGACACTCGCAC

8

CCND1(F)

GGTGAACAAGCTCAAGTGGAACC

CCND1(R)

ACCGGCCAGGGTCACCTAA

9

CCND3(F)

TTCCACGGTTGCTACATCGTG

CCND3(R)

TACACAGCAGCTCCATACTCG

10

EXO1(F)

GTTACCCGTGTTCTGCGTTGC

EXO1(R)

CGAACCCACCCATTAGCCTCC

11

FGFR2(F)

CAAGGACCACTCTTCTGCGTA

FGFR2(R)

GCTTGAATGGCAACGCTCCTC

12

HIST1H2(F)

CGTGCTACTGCCCAAGAAGAC

HIST1H2(R)

GAGCCTTTGGTTCCTTTGGGAT

13

H2AX(F)

AGGCCTCCCAGGAGTACTAAT

H2AX(R)

ACTGAAGCGGCTCAGCTCTTT

14

KU70(F)

AAGATCATAAGCAGTGATCGAGAT

KU70(R)

GTCCAGCTCCTGTAAGACGTA

15

PTEN (F)

GTCCAGAGCCATTTCCATCCTG

PTEN (R)

CTGTCATGTCTGGGAGCCTGT

16

RAD50 (F)

TGGCTGGCAGGATCTTTTGGG

RAD50 (R)

AGCTTAACTGAGGCCGAAGCA

17

RAP80(F)

CAGATGTACTGGCCACTCGGC

RAP80(R)

ACAGTGCCTAGATGTGTCCCC

18

RB1(F)

TCCGGTTTTTCTCAGGGGACA

RB1(R)

TCAGCGAGCTGTGGAGGAG

19

Rif1(F)

GGCTGTTTCCATCGGTCACTA

Rif1(R)

CTCCAAAGTCTCCAACAGCGG

20

RNF168(F)

TGAGGGGAGGAGAGGACTTGA

RNF168(R)

TAGGCAAACAGGAATACCCCG

21

TGFB1 (F)

TTGAGACTTTTCCGTTGCCGT

TGFB1(R)

TGAGGGCTGGTCCGGAATG

22

TopBP1 (F)

TGGGCGGACGAGTATACAGAC

TopBP1 (R)

AAGGTTTCTTCAGGTTTGCAGC

23

TP53 (F)

GGTCGGTGGGTTGGTAGTTTG

TP53 (R)

AGTGTGGGATGGGGTGAGATT

24

XRCC4 (F)

CAGACTTGGTTCCTTCAACCTC

XRCC4 (R)

CTCTGCAGGTGCTCATTTTTGG

25

BAX(F)

GCCTCCTCTCCTACTTTGGGG

BAX(R)

GAAACACAGTCCAAGGCAGC

26

CASP8(F)

TCTTTATGATATTGGGGAACAACTGC

CASP8(R)

CGTTCTTGCTTCCTTTGCGGA

27

CASP3(F)

ATGCAGCAAACCTCAGGGAT

CASP3(R)

CTTCACCATGGCTCAGAAGCA

28

CASP9(F)

CTCCACTTCCCCTGAAGACGG

CASP9(R)

GCTGGGTGTGGGCAAACTAGA

29

MDM2(F)

TCTTTGGGACCCATCTACCCTC

MDM2(R)

AAGAATGCTTTAGTCCACCTAACCTT

30

BCL2(F)

GAGTGGGATGCGGGAGATGC

BCL2(R)

TGGTGAAGGGCGTCAGGTG

31

RBBP8 (F)

ACCGAGGATTTGGCACTCTGA

RBBP8 (R)

ATCCGAGATTGCCTCGGGATT

32

EP300(F)

TCGGCGAATTTGTGCTCTTGT

EP300(R)

GCCTTTTTCTCTTCGCCGGGT

33

LIG4 (F)

GGGTAAAGGATCACGGGGTGT

LIG4 (R)

TCCAGACCCAACACGAGAGAG

34

C-FLIP(F)

GGCTCCCAGAGTGTGTATGGT

C-FLIP(R)

AGGCCCTCTGACACCACATAG

35

GAPDH(F)

GCTGAACGGGAAGCTCACTT

GAPDH(R)

CGCAGGTTTTTCTAGACGGCAG

36

ACTB(F)

CACCCTGAAGTACCCCATCGC

ACTB(R)

GTGTAGAAGGTGTGGTGCCAG

37

B2M(F)

TGAGTGCTGTCTCCATGTTTGAC

B2M(R)

TATTCTCTGCTCCCCACCTCT

Примечание: (F) – прямой праймер, (R) – обратный праймер

RT-PCR проводилась с использованием термоциклера CFX96 (Bio-Rad, США) и реакционной смеси, содержащей 1х PCR-буфер, смесь 0,2 мМ dNTP, 1,5 мМ MgCl2, по 450 нМ праймеров, 0,1 ед.ак./мкл Taq-полимераза и 10 нг ДНК-матрицы. В качестве интеркалирующего красителя использовался EvaGreen Dye. Относительная копийность (RQ) рассчитывалась по формуле 2-ΔCt. Конечные результаты представлялись как соотношение копийности генов в облученных образцах по отношению к контрольным для каждого гена: сRQоб/сRQк, где сRQоб – среднее RQоблученных клеток , а сRQк – среднее RQинтактных клеток (контроль), а. Статистическая обработка данных осуществлялась с использованием One-Way ANOVA.

Результаты исследования и их обсуждение

После пятидневного эксперимента по облучению опухолевых клеток предстательной железы на линейном ускорителе Novalis TX в дозе 7 Гр 15% от изначального количества клеток сохранило жизнеспособность. В этих клетках статистически значимо (р<0,05–0,005) было больше копий генов CDK-1 – в 1,8 раза, CDKN-1B – в 2,6 раза, PTEN – в 1,7 раза, XRCC-4 – в 1,7 раза, EP-300 – в 2,0 раза и RBBP-8 – в 1,7 раза относительно интактных клеток, при этом статистически значимо (р<0,05) количество копий генов CCND-3, TP53 и BCL-2 было ниже в 2,6 раза, 1,8 раза и 2,4 раза соответственно относительно клеток интактной группы (рис. 1). Можно отметить, что на выживаемость клеточных субпопуляций линии PC-3 в условиях облучения уровень копийности генов BRCA1/2, H2AX, RAD-50, RAP-80, AKT, ATM, BRIP, RIF-1, RNF-168, TOP-B1, CFLIP, CASP-8, CASP-3, CASP-9, MDM-2 и LIG-4 влияния не оказывал (копийность этих генов не отличалась в группах интактных клеток и клеток, подвергнутых облучению в дозе 7 Гр).

Рис. 1. Относительная копийность генов в радиорезистентных клетках PC-3

*– статистически значимые отличия относительно интактных клеток (р<0,05)

Так же, как и в случае с опухолевыми клетками предстательной железы после пяти дней облучения в дозе 7 Гр культуры клеток аденокарциномы толстой кишки только 20% от изначального количества клеток НТ-29, взятых в эксперимент, сохранило жизнеспособность. Повышенная устойчивость этого пула клеток относительно других клеток линии HT-29 может быть связана с аномальными показателями копийности некоторых генов в этих клетках. Это подтверждается полученными нами данными: у этих клеток статистически значимо (р<0,05) была повышена копийность генов BRCA2 – в 2,5 раза, H2AX – в 3,2 раза, CASP-9 и RBBP8 – в 1,6 раза и снижена копийность гена BCL-2 в 3,6 раза относительно клеток, не подвергнутых облучению (рис. 2).

Рис. 2. Относительная копийность генов в радиорезистентных клетках НТ-29

*– статистически значимые отличия относительно интактных клеток (р<0,05)

Из представленных данных видно, что радиорезистентные клоны опухолевых клеток разных нозологий отличаются по молекулярному профилю. В случае PC-3 радиорезистентность ассоциируется с увеличением числа копий генов CDKN-1B, CDK-1, PTEN, XRCC4, EP-300 и RBBP-8 и с уменьшением числа копий генов TP53, CCND-3 и BCL-2, а в случае клеток НТ-29 – с повышенной копийностью генов RBBP-8, BRCA2, H2AX, CASP-9 и сниженной копийностью гена BCL-2. При этом для обеих клеточных линий повышенная копийность гена RBBP8 и сниженная копийность гена BCL2 ассоциировались с устойчивостью к лучевой терапии. Белок RBBP8 регулирует пролиферацию клеток, образуя молекулярные комплексы с ко-репрессором транскрипции CTBP, а также регулирует функционирование белка BRCA1 при репарации поврежденной ДНК [7]. Продукт гена BCL2 участвует в негативной регуляции апоптоза. BCL2 изменяет проницаемость митохондриальной мембраны и предотвращает выход из митоходрий цитохрома C, что в итоге ингибирует активность каспаз. А также BCL2 связывает белок APAF1 – фактор, активирующий апоптоз [8]. Соответственно, повышенная копийность RBBP8 и сниженная копийность BCL2 дают клеткам более эффективную систему репарации ДНК и регуляции апоптоза и являются общей основой устойчивости опухолевых клеток разных нозологий к лучевой терапии.

Интересно обнаруженное увеличение копийности двух генов – CDK1 и CDKN1B – в клетках PC-3. Циклинзависимая киназа 1 (CDK1) представляет собой высококонсервативный белок, который является ключевым в регуляции клеточного цикла [9]. При его связывании с циклином происходит прогрессирование клеточного цикла. Связывание с циклином изменяет доступ к активному центру CDK1, обеспечивая его активность; кроме того, циклины могут нацеливать CDK1 на определенные субклеточные локации [9]. Продукт гена CDKN1B (cyclin-dependent kinase inhibitor 1B) белок p27 является ингибитором циклинзависимой киназы 1, регулирует клеточный цикл, отвечая за его остановку в фазе G1. p27 подавляет активность комплексов циклин (A, E или D) / циклинзависимая киназа, при этом положительная или отрицательная регуляция активности зависит от статуса фосфорилирования соответствующего комплекса [10]. Следовательно, одновременно повышается копийность гена, запускающего клеточный цикл, и гена, его останавливающего. Биологический эффект этого явления и его роль в формировании радиорезистентности опухолевых клеток еще предстоит уточнить.

Еще одно парадоксальное молекулярное изменение касается повышенной копийности генетического локуса PTEN (phosphatase and tensin homolog deleted on chromosome 10), кодирующего фермент фосфатазу, субстратами которой могут быть белки и фосфатидилинозитол-3-фосфаты. Отщепление фосфатной группы от фосфатидилинозитол-3-фосфатов, катализируемое PTEN, лишает эти соединения функций вторичных мессенджеров в клеточных сигнальных каскадах. При этом PTEN является антионкобелком, негативно регулирующим сигнальный путь PI3K/AKT/mTOR [11]. Следовательно, выжившие после облучения опухолевые клетки предстательной железы исходя из полученных данных могут иметь повышенный уровень антионкобелка PTEN.

Еще два гена, копийность которых повышена в радиорезистентных клетках предстательной железы, – это XRCC4 и EP300. Белок, кодируемый геном XRCC4, участвует вместе с ДНК-лигазой IV и ДНК-зависимой протеинкиназой в восстановлении двухцепочечных разрывов ДНК (негомологичная рекомбинация) [12]. Гистонацетилтрансфераза р300 (р300 HAT) представляет собой фермент, который в организме человека кодируется геном EP300. Данный фермент регулирует транскрипцию генов посредством ремоделирования хроматина и играет важную роль в регуляции роста и деления клеток, заставляя клетки выполнять специализированные функции (дифференцироваться). EP300 также является ко-активатором HIF1A и играет роль в стимуляции индуцированных гипоксией генов, таких как VEGF. Мутации в гене EP300 были выявлены при некоторых типах рака. Соматические мутации в гене EP300 были обнаружены в небольшом количестве солидных опухолей, включая рак толстой и прямой кишки, желудка, молочной и предстательной железы. В опухолевых клетках мутации в EP300 не позволяют продуцировать функциональный белок, без этого клетки не могут эффективно сдерживать рост и деление [13]. Вероятно, повышенная копийность XRCC4, так же как и RBBP8, обеспечивает эффективную репарацию ДНК после облучения. Роль в радиорезистентности гена EP300 определить на данный момент трудно, возможно, его копийность просто отражает молекулярно-генетические особенности выживших клонов PC-3 и не связана с чувствительностью к облучению.

Важно отметить, что в радиорезистентных клетках НТ-29 также увеличено количество копий двух генов – H2AX и BRCA2, играющих ключевую роль в репарации ДНК. В ответ на повреждение ДНК (под воздействием ЛТ) гистоновый белок H2AX фосфорилируется и переходит в форму γH2AX. Эта модификация уменьшает степень конденсированности ДНК, что позволяет присоединиться ферментным комплексам, обеспечивающим восстановление двухцепочечных разрывов. Так, γH2AX, взаимодействуя с MDC1, формирует комплекс γH2AX/MDC1, с которым соединяются убиквитинлигазы (RNF8, RNF168), что приводит к особой модификации участков хроматина, позволяющей присоединиться к нему BRCA1. В свою очередь BRCA1 образует комплекс BRCA1-PALB2-BRCA2, который необходим для важного этапа гомологичной рекомбинации – транслокации белка RAD51 к двухцепочечному разрыву ДНК [14].

Заключение

Таким образом, после пятидневной лучевой терапии при разовой очаговой дозе, равной 7 Гр, жизнеспособность сохраняют только клетки линий PC-3 и НТ-29, которые обладают особыми молекулярно-генетическими характеристиками: повышенным количеством копий генов H2AX, XRCC4, RBBP-8, CDK-1, CDKN-1B, PTEN, EP-300 и пониженным количеством копий BAX, TP53, CCND-3, BCL2 (для PC-3) либо повышенным количеством копий генов RBBP8, BRCA2, H2AX, CASP-9 и пониженным количеством копий гена BCL-2 (для НТ-29). Эти изменения копийности генов в определенных субпопуляциях опухолевых клеток PC-3 и НТ-29 приводят к повышению эффективности функционирования ключевых сигнальных путей, регулирующих репарацию ДНК, апоптоз и клеточный цикл, что в условиях лучевой терапии, вероятно, обеспечивает им эволюционное превосходство над другими клонами и в конечном итоге – их выживание. Выявленные при модельном эксперименте изменения в копийности генов раскрывают молекулярно-генетические особенности формирования радиорезистентности опухолевых клеток разных нозологий и имеют большой потенциал в качестве молекулярных маркеров чувствительности этих опухолей к лучевой терапии, что позволяет рекомендовать их для тестирования (апробации) на биоматериале, полученном от пациентов.

Исследование выполнено в рамках гос. заданий «Поиск молекулярно-генетических предикторов радиорезистентного рака предстательной железы и разработка персонифицированных терапевтических подходов» и «Поиск предикторов радиорезистентности рака прямой кишки и разработка персонифицированных неоадъювантных терапевтических подходов».


Библиографическая ссылка

Гусарева М.А., Зинькович М.С., Кошелева Н.Г., Солнцева А.А., Карнаухова Е.А., Розенко Л.Я., Фатькина Н.Б., Потемкин Д.С., Омельчук Е.П., Удаленкова И.А. ПОКАЗАТЕЛЬ КОПИЙНОСТИ ГЕНОВ И УСТОЙЧИВОСТЬ ОПУХОЛЕВЫХ КЛЕТОК РАЗНЫХ НОЗОЛОГИЙ К ОБЛУЧЕНИЮ // Современные проблемы науки и образования. – 2020. – № 5.;
URL: http://science-education.ru/ru/article/view?id=30111 (дата обращения: 29.10.2020).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074