Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,682

HETEROGENEITY OF THE EXPRESSION GENES LINKED WITH THE TH1 AND TH2-LIKE IMMUNOINFLAMMATORY REACTIONS IN MICROENVIRONMENT OF MORPHOLOGICALLY DISTINCTSUBPOPULATIONS OF TUMOR CELLSOF INVASIVE BREAST CARCINOMA

Lyapunova L.S. 1 Tashireva L.A. 1 Perelmuter V.M. 1
1 Cancer Research Institute
Несомненным на сегодняшний день является вклад воспалительной реакции опухолевого микроокружения в прогрессию карцином. В представленном исследовании нами проводилась оценка частоты встречаемости и уровня экспрессии генов, маркеров Th1- и Th2-подобных иммуновоспалительных реакций (ИВР) в строме, прилегающей к различным морфологически обособленным структурам инвазивной карциномы молочной железы неспецифического типа (ИКНТ). Методом полимеразной цепной реакцией в режиме реального времени определена частота и уровень экспрессии генов TBX21, GATA3, TGFβ, IL-12 и IFNγ в клетках, располагающихся вблизи разных морфологических структур опухоли. Было показано, что в микроокружении ИКНТ с наибольшей частотой встречается экспрессия генов, свойственных клеткам, формирующим Th2-подобные ИВР. При этом вблизи тубулярных структур реакции подобного типа не встречаются. Статистически значимых различий в уровне экспрессии всех включенных в исследование генов вблизи различных морфологически обособленных структур инвазивной карциномы молочной железы обнаружено не было. Таким образом, ИВР в микроокружении морфологически обособленных структур ИКНТ гетерогенны. ИВР Th2-подобного типа не встречаются вблизи тубулярных структур, чем можно объяснить связь последних с благоприятным прогнозом рака молочной железы.
The contribution of inflammatory reaction of tumor microenvironment to cancer progression is unquestionable today.In the presented study we estimated the frequency of Th1- and Th2-like immunoinflammatory reactions (IIR) linked gene expression in the stroma adjacent to various morphologically distinct structures of invasive breast carcinoma non-specific type (IC NST). Using real-time PCR the frequency and level of expression of the TBX21, GATA3, TGFβ, IL-12 and IFNγ genes in cells located near the tumor various morphologically distinct structures was determined. It was shown that expression of genes peculiar to Th2-like IIR most common occurs in the microenvironment of IC NST. In this case, there are no similar reactions near tubular structures. There were no significant differences in the level of expression of all genes included in the study near different morphologically distinct structures of invasive breast carcinoma. Thus, IIR in the microenvironment of morphologically distinct structures of IC NST are heterogeneous. Th2-like IIR type does not occur near tubular structures, which explains the association tubular structures with the favorable prognosis of breast cancer.
immunoinflammatory reactions
th2-lymphocytes
morphological heterogeneity
breast cancer

Актуальность. Рак молочной железы сохраняет лидирующие позиции в структуре смертности от онкологической патологии среди женского населения России [1]. Механизмы прогрессирования данного заболевания, несмотря на внушительный объем накопленных знаний, остаются не ясными. Тем не менее на сегодняшний день сложено представление, что обуславливать прогрессию опухоли могут не только сами злокачественные трансформированные клетки первичного узла, но и не опухолевые клетки [2]. Среди клеток, инфильтрирующих строму, встречаются эндотелиальные клетки и их предшественники, фибробласты, нейтрофилы, эозинофилы, базофилы, тучные клетки, Т- и В-лимфоциты, естественные клетки-киллеры, антиген-презентирующие клетки (макрофаги и дендритные клетки) [3]. Описанные популяции клеток, совместно с молекулами внеклеточного матрикса, формируют опухолевое микроокружение. Формирование микроокружения происходит в ответ на опухоль, иногда при активном ее участии, и может быть охарактеризовано термином иммуновоспалительная реакция (ИВР) [4]. Современные знания позволяют полагать, что тип ИВР, развертывающейся в опухоли, способен во многом определять течение опухолевой болезни [5]. Для отдельных клеток, формирующих определенные типы ИВР, хорошо известна прогностическая значимость. Так, показано, что CD4+Th1 (T-helper 1), CD8+ цитотоксические Т-клетки, NK (naturekiller) – клетки и M1 макрофаги ассоциированы с ингибированием опухолевого роста, в то время как CD4+ Th2 (T-helper 2), макрофаги M2 типа и клетки супрессоры миелоидного происхождения способствуют росту опухоли [6]. Довольно часто высокая инфильтрация Th2-лимфоцитами опухолевого узла отмечается у пациентов с распространенным люминальным раком молочной железы (РМЖ) [7,8]. Несмотря на накопленные знания, выраженность инфильтрации стромы опухоли различными субтипами лимфоцитов не рассматривается как надежный прогностический фактор течения РМЖ.

Причина может крыться в высокой гетерогенности РМЖ, в частности, и морфологической гетерогенности, проявляющейся наличием различных структур, образуемых опухолевыми клетками. Известно, что наличие альвеолярных структур взаимосвязано с лимфогенным метастазированием [9]. Таким образом, целью данного исследования было изучение частоты встречаемости и уровня экспрессии генов, ассоциированных с Th2-подобным иммунным ответом вблизи пяти морфологических структур инвазивной карциномы молочной железы неспецифического типа.

Материалы и методы

В исследование были включены 10 больных с инвазивной карциномой молочной железы неспецифического типа (ИКНТ) в возрасте от 44 до 70 лет (средний возраст составил 56[49–66] лет), которым была проведена радикальная мастэктомия или секторальная резекция с интраоперационной лучевой терапией в дозе 10Гр. Неоадъювантной химиотерапии больные не получали. Все пациенты включались в исследование на основании добровольного информированного согласия и с разрешения локального этического комитета (№ 8 от 17.06.16 г.). В исследуемой группе производилась оценка основных клинико-патологических параметров: размера опухоли, принадлежности к определенному молекулярно-генетическому подтипу, выраженности воспалительной реакции в строме. Из свежезамороженного операционного материала были приготовлены гистологические срезы, окрашенные гематоксилином. После этого с помощью технологии лазерной микродиссекции PALM (CarlZeiss, Германия) было выделено микроокружение вблизи различных типов морфологических структур опухоли. У каждой пациентки было изолировано не менее 100 морфологических структур каждого типа, среди которых были: альвеолярные, солидные, трабекулярные, тубулярные структуры и дискретные группы опухолевых клеток. Затем из полученных образцов по адаптированному протоколу была выделена тотальная РНК сорбентно-колоночным методом с помощью наборов RNeasyPlusMicroKit (Qiagen, США) и проведена амплификация транскриптома с использованием набора QuantiTect WTA Kit (Qiagen, США). Оценка экспрессии генов, характеризующих клеточный состав локальных микроокружений (TBX21 - T-boxtranscriptionfactor 21, GATA3 - GATA bindingprotein 3) и генов цитокинов (TGFβ - transforminggrowthfactor, beta, IL-12 - interleukin 12 и IFNγ - interferongamma) производилась методом ПЦР в режиме «реального времени» с использованием TaqMan-зондов и специфических праймеров. Последовательности специфических праймеров и проб представлены в таблице 1.

Таблица 1

Последовательность специфических праймеров и проб

Ген

Полное название

Праймеры и проба (5'-3')

TBX21

T-boxtranscriptionfactor

F 5'- CTCACAAACAACAAGGGGGC -3'

R 5'- CGGGGCTGGTACTTATGGAG -3'

PROBE 5'- ACCCAGATGATTGTGCTCCAGTCC -3'

IL-12

Interleukin 12

F 5'- GCCTTCACCACTCCCAAAAC -3'

R 5'- GTAAACAGGCCTCCACTGTG -3'

PROBE 5'- CTGAGGGCCGTCAGCAACATGC -3'

IFNγ

Interferongamma

F 5'- TCGTTTTGGGTTCTCTTGG -3'

R 5'- TCTGTCACTCTCCTCTTTCC -3'

PROBE 5'- TGCAGGTCATTCAGATGTAGC -3'

GATA3

GATA binding protein 3

F 5'- ACCCCATCACCACCTACCC -3'

R 5'- GTTCACACACTCCCTGCCTT -3'

PROBE 5'- CAAGGCCCGGTCCAGCACAG -3'

TGFβ

Transforming growth factor, beta

F 5'- CCACCCCGCTGGAGAGG -3'

R 5'- GCCGCACGCAGCAGTTC -3'

PROBE 5'- CACCAACTATTGCTTCAGCTCCACGG -3'

ACTB

Actin, beta

F 5'- GAGAAGATGACCCAGATCATGTT -3'

R 5'- ATAGCACAGCCTGGATAGCAA -3'

PROBE 5'- AGACCTTCAACACCCCAGCCAT -3'

 

Относительный уровень экспрессии изучаемых генов рассчитывали с использованием метода Пфаффла. Нормализацию уровня экспрессии проводили относительно экспрессии ACTB (actin, beta; гена «домашнего хозяйства»).

Статистическая обработка данных проводилась с использованием пакета программ «Statistica 8.0». Для сравнения частоты встречаемости экспрессии маркерных генов применялся точный критерий Фишера, а результаты считались статистически значимыми при р<0,05.

Результаты и обсуждение

Реализация функции клеток инфильтрата возможна только на расстоянии действия цитокинов в ткани [10]. В этой связи в своем исследовании мы анализировали экспрессию генов в клетках, находящихся в непосредственной близости от опухолевых структур.

В первую очередь мы сравнили частоту встречаемости экспрессии генов, относящихся к одинаковому типу ИВР (табл. 2).

Таблица 2

Частота встречаемости экспрессии геновTh1-, Th2-подобных иммуновоспалительных реакций (ИВР) в строме ИКНТ молочной железы

Тип ИВР

Ген

Частота встречаемости экспрессии % (абс.)

Th1

TBX21

12,2 (6/49)

IL-12

18,4 (9/49)

р1=0,58

IFNγ

24,5 (12/49)

р1=0,19; р2=0,62

Th2

GATA3

30,6 (15/49)

р1=0,04

TGFβ

44,9 (22/49)

р3=0,21; р2=0,01; р4=0,05

Примечание: р1 – по сравнению с частой встречаемости экспрессии гена TBX21; р2 – по сравнению с частой встречаемости экспрессии гена IL-12; р3 – по сравнению с частой встречаемости экспрессии гена GATA3; р4 – по сравнению с частой встречаемости экспрессии гена IFNγ.

Было показано, что экспрессия генов GATA3 и TGFβ (ИВР Th2-подобного типа) встречается с одинаковой частотой (p=0,21) в клетках микроокружения ИКНТ молочной железы, что свидетельствует об активном состоянии клеток. Аналогичная ситуация складывалась и в отношении генов TBX21, IL-12 и IFNγ (ИВР Th1-подобного типа) (p>0,05).

Далее мы сравнили, какой тип реакции встречается чаще. Показано, что чаще обнаруживается экспрессия транскрипционного фактора GATA3 по сравнению с TBX21 (р=0,04). Ген, кодирующий цитокин Th2-подобного типа (TGFβ), экспрессировался чаще, чем IL-12 и IFNγ (р=0,01 и р=0,05 соответственно), являющихся цитокинами Th1-подобного типа. Таким образом, данный блок исследования показывает, что у большинства больных ИКНТ молочной железы в строме опухолевого узла развивается ИВР Th2-подобного типа.

Затем, принимая во внимание морфологическую неоднородность ИКНТ молочной железы, мы сравнили частоту встречаемости экспрессии генов вблизи альвеолярных, тубулярных, трабекулярных, солидных опухолевых структур и дискретных опухолевых клеток (табл. 3).

Таблица 3

Частота встречаемости экспрессии генов Th1-, Th2-подобных иммуновоспалительных реакций (ИВР) вблизи опухолевых структур ИКНТ молочной железы

Тип ИВР

Ген

Микроокружение вблизи опухолевых структур % (абс.)

альвеолярные

солидные

трабекулярные

тубулярные

дискретные клетки

Th1

TBX21

0 (0/10)

30 (3/10)

10 (1/10)

11,1 (1/9)

10 (1/10)

IL-12

10 (1/10)

30 (3/10)

30 (3/10)

0 (0/9)

20 (2/10)

IFNγ

30 (3/10)

20 (2/10)

30 (3/10)

22,2 (2/9)

20 (2/10)

Th2

GATA3

30 (3/10)

50 (5/10)

40 (4/10)

0 (0/9) р=0,04

30 (3/10)

TGFβ

40 (4/10)

60 (6/10)

50 (5/10)

22,2 (2/9)

50 (5/10)

Примечание: р – по сравнению с частой встречаемости экспрессии гена GATA3 вблизи солидных и трабекулярных опухолевых структур.

Оказалось, что частота встречаемости экспрессии генов TBX21, IL-12 и IFNγ не различалась среди клеток микроокружения, вблизи представленных морфологических структур (p>0,05), таким образом можно говорить об одинаковой выраженности ИВР Th1-подобного типа во всех исследованных локусах. Напротив, при анализе генов, относящихся к ИВР Th2-подобного типа, было отмечено отсутствие экспрессии транскрипционного факторы GATA3 вблизи тубулярных структур (p=0,04) (рис.1). При этом частота встречаемости экспрессии гена TGFβ в клетках микроокружения морфологически обособленных опухолевых структур не различалась (p>0,05).

Рис. 1. Частота встречаемости экспрессии гена GATA3 вблизи различных

морфологических структур опухоли

И наконец, мы провели сравнительный анализ уровня экспрессии генов TBX21, GATA3, TGFβ, IL-12 и IFNγ вблизи опухолевых структур (рис. 2).

Рис. 2. Тепловая карта экспрессиигенов Th1-, Th2-подобных иммуновоспалительных реакций вблизи опухолевых структур ИКНТ молочной железы

Примечание: зеленый – низкий уровень, красный высокий уровень экспрессии анализируемых генов.

Было показано, что статистически значимых различий в уровне экспрессии всех включенных в исследование генов вблизи различных морфологически обособленных структур инвазивной карциномы молочной железы обнаружено не было.

Заключение

Таким образом, в результате проведенного нами исследования было обнаружено, что ИВР в строме опухоли гетерогенны. С наибольшей частотой в строме опухолевого узла встречается ИВР Th2-подобного типа, при этом в части случаев ИВР в микроокружении опухоли отсутствует. Оценка иммунного инфильтрата вблизи различных морфологических структур опухоли показала отсутствие воспалительной реакции Th2-подобного типа вблизи тубулярных структур. В настоящее время подсчет тубулярных структур используют в системе Grade как один из параметров, позволяющий оценить степень дифференцировки опухоли [11]. Большое количество данных структур в опухолевом узле ассоциировано с лучшим прогнозом. Возможным объяснением данного феномена может являться отсутствие иммунного инфильтрата, характерного для ИВР Th2-подобного типа, зафиксированное в нашем исследовании. Последние, большинством авторов, оцениваются как реакции с проопухолевым эффектом и ассоциированы с ухудшением прогноза и высоким риском рецидива и развития метастатической болезни [12].