Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,791

DNA MARKERS STUDY OF SUNFLOWER RESISTANCE TO BROOMRAPE (OROBANCHE CUMANA WALLR.)

Markin N.V. 1 Usatov A.V. 1 Makarenko M.S. 1 Usatenko T.V. 2 Gorbachenko O.F. 2
1 Southern Federal University
2 Don Experimental Station L.A. Zhdanov's All-Russia Research Institute of oilseeds
С помощью молекулярно-генетического анализа образцов подсолнечника Донской опытной станции им. Л.А. Жданова ВНИИМК, с контрастной устойчивостью/чувствительностью к заразихе, был проведен поиск информативных RAPD-, SSR- и SCAR-маркеров. Среди исследованных 18 RAPD-маркеров специфичных для устойчивых образцов не обнаружено, однако два маркера - OPA17_1800 и UBC685_1500 были амплифицированы у 81% чувствительных образцов. 11 SSR-маркеров, взятые в анализ, также не позволили идентифицировать устойчивые генотипы. Среди изученных 9 SCAR-маркеров отсутствие амплификации двух - RTS 40 и RTS 40_1, позволили выделить группу неустойчивых образцов. Прямое секвенирование этих двух ампликонов - RTS 40 и RTS 40_1, полученных у неустойчивых растений, и их выравнивание с помощью программы Blast в GenBank NCBI выявило гомологию с последовательностью семейства генов NBS-LRR (№ HQ222362.1, GenBank NCBI), контролирующих устойчивость подсолнечника к комплексу патогенов. Сделано предположение, что участок NBS-LRR полиморфен у образцов, различающихся по устойчивости к заразихе, и что праймеры маркеров RTS 40 и RTS 40_1 комплементарны участкам, характерным неустойчивым образцам. Разработаны и апробированы 11 новых маркеров генов NBS-LRR и межгенных регионов локуса № HQ222362.1. Среди них два маркера - Zar1 и Zar2 - амплифицировались только у устойчивых к заразихе генотипов, тем самым подтвердив свою ценность в селекции подсолнечника.
The investigation of DNA-markers (RAPD, SSR, SCAR) associated with resistance to broomrape was revealed. The research was conducted on sunflower lines obtained from Zhdanov Don Experiment Station of All Russia Research Institute of Oil Crop. All the 18 RAPD were not clearly informative, however the OPA17_1800 and UBC685_1500 markers were amplified in 81% of nonresistant lines. All the 11 investigated SSR-markers have been also useless for identification of resistant genotypes. Among the studied 9 SCAR-markers only RTS 40 and RTS 40_1 allowed to select a group of nonresistant lines, which had specific amplicons. The Sanger sequencing of this amplicons and their alignment in NCBI database using Blast have revealed similarity to NBS-LRR-encoding genes (NCBI accession HQ222362.1). NBS-LRR genes are associated with pathogenic resistance and high duplicated, since there is a polymorphic cluster of NBS-LRR-encoding genes. Thus we developed and tested 11 new markers to coding (NBS-LRR) and intergenic regions of the HQ222362.1 locus. Among them, two markers - Zar1 Zar2 allowed to identify broomrape resistant genotypes by specific amplicons.
genotyping
DNA markers
sequencing
sunflower broomrape
resistance
marker-assisted selection
sunflower

Заразиха подсолнечная (Orobanche сumana Wallr.) представлена многочисленными расами, постоянно возникающими в результате сопряженной эволюции паразита и хозяина, которые способны преодолевать иммунитет устойчивых генотипов. В последнее время на юге России сотрудниками ВНИИ масличных культур дифференцировано 8 рас O. cumana: A, B, C, D, E, F, G, H [1; 3; 4]. Угроза снижения урожаев подсолнечника вследствие быстрого распространения новых рас заразихи на юге РФ актуализировала направление селекции подсолнечника на создание устойчивых генотипов к этому растению-паразиту.

Внедрение молекулярных маркеров в современные селекционные программы позволяет многократно повысить эффективность отбора перспективных образцов, в том числе устойчивых к патогенам [10; 11].

Целью работы является поиск информативных ДНК-маркеров устойчивости подсолнечника к заразихе.

Материалы и методы

На инфекционном фоне в оранжерее Донской опытной станции им. Л.А. Жданова ВНИИ масличных культур были выделены образцы, контрастно различающиеся по устойчивости/чувствительности к наиболее вирулентным в Ростовской области расам заразихи O. cumana (табл. 1). Для создания инфекционного фона использовали смесь семян заразихи, собранных в различных районах и агроклиматических зонах Ростовской области. Поражаемость оценивали по наличию проростков заразихи на корнях исследуемых образцов. В работе использовали 18 RAPD-маркеров: P36, P37, P38, P46, P53, OPT-08, OPW-04, OPW-06, OPW-09, OPW-10, OPW-15, OPX-01, UBC-73, UBC-120, UBC-264, UBC-318, UBC-685, OPA-17 [7]; 11 SSR-маркеров: ORS 1222, ORS 1114, ORS 1036, ORS 1056, ORS 1040, ORS 202, ORS 1112, ORS665, ORS 1021, ORS 718, ORS 545 [12] и 9 SCAR-маркеров: RTS05, RTS 05_1, RTS 28, RTS 29, RTS 29_1, RTS40, RTS40_1, RTS 41, RTS 43 [8], ассоциированных, по данным литературы, с устойчивостью подсолнечника к O. cumana.

Таблица 1

Образцы подсолнечника, исследованные на наличие ДНК-маркеров устойчивости к заразихе

№ пробы

Генотипы, устойчивые

к заразихе

№ пробы

Генотипы, не устойчивые

к заразихе

1

J-2/2979

22

С-1/98

2

C-1/87

23

С-1/132

3

C-1/144

24

J-2/4341

4

J-3/2822

25

Донской 22

5

J-3/2825

26

J-2/4412

6

J-4/495

27

J-5/169

7

J-4/501

28

J-5/931

8

J-4/507

29

J-5/236

9

J-4/509

30

J-5/1448

10

J-4/517

31

J-4/169

11

J-4/525

32

J-4/931

12

J-3/2849

33

J-4/236

13

J-4/541

34

J-5/73

14

J-4/546

35

J-5/383

15

J-3/3136

36

J-5/869

16

J-4/746

37

J-5/169

17

J-4/756

38

J-5/931

18

J-4/759

39

J-3/236

19

J-2/4402

40

J-3/73

20

J-2/4405

41

J-3/45

21

J-2/4417

 

 

 

Геномную ДНК выделяли из высечки листовой ткани сорбентным методом [9]. Полимеразную цепную реакцию проводили согласно [2]. Реакцию амплификации проводили в термоциклере Palm-Cycler (Corbett Research, Австралия) по следующей программе для RAPD анализа: 1) один цикл: 4 мин. 94 °С; 30 циклов: 1 мин. 94 °С, 1 мин. 37 °С, 1 мин. 72°С; один цикл: 10 мин. 72 °С; для SSR- и SCAR-анализа 1) один цикл: 4 мин. 94 °С; 35 циклов: 1 мин. 94 °С, 1 мин. 60 °С, 1 мин. 72°С; один цикл: 10 мин. 72 °С. Очистку фрагментов амплифицированной ДНК для прямого секвенирования выполняли согласно [13]. Нуклеотидные последовательности определяли с использованием набора реагентов ABI Prism BigDye Terminator v.3.1.(«Applied Biosystems», USA) согласно прилагаемой инструкции с последующим анализом продуктов на секвенаторе ABI Prism 3130xl. Хромотограммы анализировали с помощью пакета программ BioEdit 7.0.9.0. [6].

Для дизайна праймеров использовали программу Primer Quest Tool от Integrated DNA Technologies, Inc.

Результаты

Среди исследованных 18-ти RAPD маркеров, специфичных для устойчивых образцов не обнаружено, однако два маркера - OPA17_1800 и UBC685_1500, были амплифицированы у 81% чувствительных образцов. Интересно отметить, что RAPD маркер UBC120_660, описанный в работе [8], как ассоциированный с устойчивостью к заразихе, оказался не информативным в нашей выборке генотипов. Остальные маркеры также оказались неинформативными для кластеризации генотипов по признаку устойчивости/чувствительности к патогену.

Результаты амплификация ДНК изучаемых образцов с 11 SSR-праймерами показали, что электрофоретические профили существенно отличаются друг от друга, однако они также не коррелировали с устойчивостью подсолнечника к заразихе.

Из 9 SCAR-маркеров, только два - RTS 40 и RTS 40_1, позволили кластеризовать исследуемые генотипы. На электрофореграммах у всех устойчивых образцов отсутствовали бэнды размером около 360 п.н. (маркер RTS 40) и 300 п.н. (маркер RST 40_1), которые были характерны для неустойчивого к заразихе подсолнечника.

В дальнейшем мы провели секвенирование этих двух ампликонов, последовательности нуклеотидов которых приведены в таблице 2.

Таблица 2

Последовательности нуклеотидов ДНК фрагментов

ДНК-маркеры

Последовательность нуклеотидов

RTS 40

ACAATGGCCGCCGAAGCCCACTGCGGTAACCCGGTTCGGCTCGGTTTCGAACTGACGATCTCCAAAGAGGCCTAGTTCTAAACTTCATTGCCACCACCAATGTCCTTCAAAGTGATGCTAGTGGGAGTAAACCCCTAATGTGAGCTCGACAATAGCTTGAAAATTGTAATCATAACTAAGCTTGATGAAATAACTCGGATTTAAAAGCTTTAATGGCTTGATATGTCTAGTAGAGTTTCGTTGATAAAATGGCCCAAAATATATGTTCAAATCGCTCGTCGCTTATCGCTCGCTCGCCGATCGTTCGGAAAACGCTCGGAATATGTCCGCTCGGTGGAA

RTS 40_1

GGCATTTTTATCACGAAACTCTACTAGACATATCAAGCCATTAAAGCTTTTAATCCGAGTTATTTCATCAAGCTTAGTTATGATTACAATTTTCAAGCTATTGTCGAGCTCACATTAGGGGTTTACTCCCACTAGCATCACTTTGAAGGACATTGGTGGTGGCAATGAAGTTTAGAACTAGGCCTCTTTGGAGATCGTCAGTTCGAAACCGAGCCGAACCGGGTTTTACCGCAGTGGGCCTTCGGGCGGCGGGTTTTCTCCGGAACTGGTAGCTCA

 

Данные последовательности были проанализированы с помощью программы Blast в GenBank NCBI. Оказалось, что нуклеотидные последовательности фрагмента ДНК, амплифицированного с праймером RTS 40 на 98%, а с праймером RTS 40_1 на 81% гомологичны последовательности № HQ222362.1 в GenBank [5], в которой расположены гены NBS-LRR, контролирующие устойчивость подсолнечника к комплексу патогенов.

Исходя из полученных результатов, был расширен поиск маркеров, ассоциированных с устойчивостью к заразихе, и определены 11 новых маркеров генов NBS-LRR и межгенных регионов локуса № HQ222362.1. Для идентификации этих маркеров нами были разработаны новые праймеры (табл. 3).

Таблица 3

Праймеры для идентификации генов NBS-LRR и межгенных регионов

Локус

Последовательность оснований (5'-3')

Размер, п.н.

Тm, 0С

GenBank

1

Zar1

GCATCACTTTGAAGGACATTGG

ATGCGTTGTGTAATTCTTGTATGG

529

60

HQ222362.1

2

Zar2

CCAACTCTGACCGTTATGAAGA

GCGATGTCTAGTTGTTTGGTTG

437

60

HQ222362.1

3

Zar3

TATGGAGGATCTGGTCGGTTAG

GAAAGTGGTTGTGAGTGAAGGA

716

60

HQ222362.1

4

Zar4

CAACCATGCACTCCCAATTTAC

GTTGCCCAACAACTTCCTAATG

990

60

HQ222362.1

5

Zar5

TAAACAAGAAGCAAGGCATCAAG

GTGCTCTATCGAACGGGAATAA

317

60

HQ222362.1

6

Zar6

TGGGTAATCTCCTACTACCCTAAA

GAATGCCAAGTTCTTCTCGAATG

301

60

HQ222362.1

7

Zar7

CGAACAACTGGTGTGCATTT

GTGTTGCCACTGCAAGTTATG

356

60

HQ222362.1

8

Zar8

CCCAACGTCTCAACGTTATCT

GGGAGAAATGGGCAAACAATAC

568

60

HQ222362.1

EU924141.1

9

Zar9

ACATGCCTTTCTGTGAATGGA

GAGTTCAGGATCTGGGATTTGG

206

60

HQ222362.1

10

Zar10

CCAACCCAAATGACCAAGAATAG

CTGATGCCCGAGAGTCTTTAC

234

60

HQ222362.1

11

Zar11

GCAGTGAGGACGGTTGTTAG

AAGCAGAACAATGATGGACAAATC

200

60

HQ222362.1

Из 11 маркеров только два – Zar1 и Zar2, оказались информативными для идентификации генотипов, устойчивых к заразихе. Так, у 90% устойчивых форм наблюдается амплификация фрагментов 529 и 437 п.н., отсутствующих у поражаемых образцов.

Выводы

С помощью 18 RAPD-, 11 SSR- и 9 SCAR-маркеров, которые, по данным литературы, ассоциированы с устойчивостью подсолнечника к заразихе, были генотипированы образцы Донской опытной станции ВНИИМК, контрастно различающиеся по устойчивости/чувствительности к наиболее вирулентным в Ростовской области расам. Ни один из этих маркеров не был специфичным для устойчивой группы генотипов. Однако два RAPD-маркера - OPA17_1800; UBC685_1500 и два SCAR-маркера - RTS 40; RTS 40_1 были характерны для неустойчивых к заразихе образцов.

Прямое секвенирование и поиск гомологии в GenBank NCBI маркеров - RTS 40 и RTS 40_1, позволил найти последовательность семейства генов NBS-LRR, контролирующих устойчивость подсолнечника к комплексу патогенов. Используя последовательность локуса NBS-LRR (№ HQ222362.1, GenBank NCBI), были определены 11 новых маркеров генов и межгенных регионов. Среди них два маркера - Zar1 и Zar2 - оказались информативными для идентификации генотипов, резистентных к заразихе. Эти маркеры могут представлять непосредственный интерес в селекции подсолнечника.